Author: has written 164 posts for this blog.

Readers are cordially invited to follow our guidelines to submit a Guest Post pitch for consideration.
Return to: Homepage | Blog Index

427 Responses

    1. Li
      Li February 5, 2013 at 2:31 pm |

      Got as far as “the prostituted woman”. Which is to say, halfway through the second sentence.

    2. jemima101
      jemima101 February 5, 2013 at 2:58 pm |

      Thats the blog I referred to, I refused to link , just as I would refuse to a racist denying racism, or an MRA saying women have equality. My estimation for various women I respected went done considerably when they retweeted it with praise.

      1. Elle Fury
        Elle Fury February 5, 2013 at 7:41 pm |

        Do you have trouble with reading comprehension, jemima101? How is the author anything like a racist or MRA. Seriously. Explain yourself.

        1. PeggyLuWho
          PeggyLuWho February 5, 2013 at 11:46 pm |

          I believe ze covered it with “silencing, patronizing dangerous and wrong”. Seriously, I read about five sentences and I wanted to puke, it’s so thick with condescension and paternalistic bullshit, to say nothing of errant assumptions. “Those dumb broads think they’re empowered. Amirite?” FTS.

        2. jemima101
          jemima101 February 6, 2013 at 3:45 am |

          Mods can we think about personal attacks?

          As I have explained, racists and MRAs take it upon themselves to explain that racism and misogyny do not exist. They tell PoC and women that there views and lived experience are invalid arguments. The article does exactly the same re sex workers. Sex workers other than me are following this thread, they feel unable to comment because of their previous experiences in feminist spaces. I have been told I am not fir to walk the streets and compared to a banana at feminist conferences.

          Our experience should be listened to, silencing us is exactly the same as silencing anyone else. If we say an oppression exists feminists should be listening, not denying.

    3. Donna L
      Donna L February 5, 2013 at 5:52 pm |

      I’ve always found it interesting (but hardly surprising) that there’s such a direct correspondence between the most well-known “anti-trafficking” and anti-sex work feminists (such as Julie Burchill, Julie Bindel, and Sheila Jeffries), and the most well-known . . . . guess what kind of feminists?

      So it’s no surprise that Feminist Current has a lengthy interview with Sheila Jeffries on its website, in which she expounds at length on her theories about “transgenderism.”

      It may not be entirely fair to condemn a cause because its most prominent advocates are all completely loathsome about certain other issues, but until this particular movement stops being so closely associated with famous transphobes, I want nothing to do with it.

      I wonder what their movement’s position is with respect to sex workers who are trans women? I did once see one of them (I forget which one) say that it’s not within their purview, because their concern is women, and they’re not experts in male prostitution. Nice.

      1. Donna L
        Donna L February 5, 2013 at 5:53 pm |

        A comment is in moderation pointing out how transphobic that publication is. As are most of this movement’s most well-known spokespeople.

    4. C.
      C. February 5, 2013 at 6:05 pm |

      An absolutely outstanding read.

      1. jemima101
        jemima101 February 5, 2013 at 6:08 pm |

        Presumably by oustanding you mean silencing, patronizing dangerous and wrong…it’s ok, I know about the language difference, you say diaper, we say nappy.

    5. dc
      dc February 5, 2013 at 7:37 pm |

      an unfortunately trans phobic website
      http://feministcurrent.com

      1. Elle Fury
        Elle Fury February 5, 2013 at 7:43 pm |

        How is it transphobic? Are you critical thinking phobic?

        1. dc
          dc February 5, 2013 at 11:56 pm |

          read down the thread.
          bye.

      2. Meghan Murphy
        Meghan Murphy February 5, 2013 at 8:19 pm |

        Oh for Christ’s sake. Is this the best you can do? To liken me to a racist or an MRA? And then when you run out of ideas, you call my site ‘transphobic’? I suppose it says a lot about the strength of your arguments if all you can manage to drum up is bullshit and slander.

        1. jemima101
          jemima101 February 5, 2013 at 8:20 pm |

          Ahhh the terfs have arrived, denying the right of anyone to disagree, because they are the twue feminists.

        2. dc
          dc February 5, 2013 at 8:35 pm |

          [i used to read the website a bit till it seemed trans phobic to me.ok?so... whatever.ya call em as ya see em.yell at me if you like.actually~ its disappointing.if you want to make a point for your opinions, that might be addressed first.or not.up to you.i know that im not the first to suggest this idea,tho.whether politely or not.and this issue divides feminism far more then sex work does,as you well know.]

        3. Katniss
          Katniss February 5, 2013 at 8:37 pm |

          Are you arguing that the linked site ISN’T transphobic? Because it took me under five minutes to find a recent transphobic argument there.

        4. jemima101
          jemima101 February 6, 2013 at 3:09 am |

          It took me 30 seconds, that doesn’t matter though. If a person who belongs to an oppressed group says your behaviour is oppressive you STFU and listen. You do not deny it, that is understanding your privilege 101.

          I am white, educated, cis and pass for straight, abled , so on certain things, including but not limited to disability, race, queerness, trans issues, my voice should be one of being an ally and always accepting if someone tells me I have failed. I do not get to say, oh no that isnt racist, or whatever.

          Seriously on a respected feminist website do I have to explain this?

        5. macavitykitsune
          macavitykitsune February 5, 2013 at 8:48 pm |

          Wait, are you trying to say that you defended that disgusting turdsplosion by Julie Burchill and that somehow doesn’t impact your apparent trans-friendliness?

          Are you kidding me?

        6. macavitykitsune
          macavitykitsune February 5, 2013 at 8:50 pm |

          Oh, and also: it’s not bullshit and slander. It’s resignation and facts. o_O Good fucking gods.

        7. dc
          dc February 5, 2013 at 9:53 pm |

          (hmmmm i think we are all still waiting for Meghan to answer that question?
          well?)

        8. Li
          Li February 6, 2013 at 12:24 am |

          In what universe is the article I wrote addressing the imaginary ‘war’ against sex workers ‘transphobic’?? This is some serious crazy-making y’all have gotten into.

          So obvs Meghan isn’t actually going to give a shit about the answer to this, and I’m not actually going to risk the aneurysm reading her article in full would likely give me, but the issues of anti sex worker activism and transphobia are actually pretty strongly related to because of trans* women’s relatively high representation in sex trades. Trans* women have both additional incentives for engaging in sex work (the only industry in which the wage gap between trans and cis women is reversed, ability to transition while working without facing massive employment discrimination, high pay rates to help offset the cost of transition) and survival sex (increased levels of homelessness and poverty) as well as increased exposure to violence (including by cops).

          Trans women in general, like women of colour, also face profiling as sex workers, especially when those two actors intersect, so anti sex work interventions don’t just impact trans* women who actually are sex workers, but also other trans* women.

          So when people like DonnaL raise the issue of transphobia by anti sex work activists, it’s not just an interesting sideline of fail that’s ultimately irrelevant to the discussion. Not giving a shit about trans* women is pretty integral.

      3. Meghan Murphy
        Meghan Murphy February 5, 2013 at 8:31 pm |

        PLEASE go ahead and disagree! I’d be stoked if you actually engaged with the arguments being made rather than just resort to trying to discredit via lies.

        1. dc
          dc February 5, 2013 at 8:42 pm |

          To liken me to a racist or an MRA
          how ?
          [but actually, i dont want to derail here.
          the topic is very important.
          so..oh well.]

        2. dc
          dc February 5, 2013 at 9:56 pm |

          cinc fail
          i think we are all still waiting for Meghan to answer that question?
          well?

      4. Meghan Murphy
        Meghan Murphy February 5, 2013 at 8:55 pm |

        It’s my site. And it isn’t ‘transphobic’, no. Like the site, don’t like the site, I don’t care. But don’t dismiss valid arguments based on bullshit labels. It does seem like a great way to derail, though!

        1. macavitykitsune
          macavitykitsune February 5, 2013 at 9:03 pm |

          And it isn’t ‘transphobic’, no.

          Right. You said so, so it must be true! How could us silly ladypeople know for ourselves what is or isn’t transphobic.

          But don’t dismiss valid arguments based on bullshit labels.

          …seriously? Saying that you’re making a transphobic argument is assigning a bullshit label? Wow. Unless, of course, you think transphobia itself to be a bullshit label. In which case we have nothing to discuss, as you’ve proved yourself irretrievably water-brained.

        2. Meghan Murphy
          Meghan Murphy February 5, 2013 at 9:07 pm |

          It’s bullshit because it’s not true. Like, based on nothing true. Therefore, bullshit.

        3. Donna L
          Donna L February 5, 2013 at 9:09 pm |

          Sorry, you don’t get to decide whether you’re transphobic or not. This is not a place for the obsessively Stalinist wing of feminism, which aptly describes you and yours. You publish an approving interview with that disgusting, lying bigot Sheila Jeffreys, with her fantasies about how “transgenderism” — a word she deliberately chose to make it sound like some sort of religious choice, like Lutheranism or Marxism — was recently “invented,” and expect not to be called what you are?

          There are no legitimate “arguments” to engage with on the subject, any more than I’d “engage” with flat-earthers. Get lost.

        4. macavitykitsune
          macavitykitsune February 5, 2013 at 9:09 pm |

          It’s bullshit because it’s not true. Like, based on nothing true. Therefore, bullshit.

          Clarify the “it”, please. Does it=the assertion that your site is transphobic, or does it=transphobia? I ask because I sincerely don’t want to get something wrong.

        5. Donna L
          Donna L February 5, 2013 at 9:11 pm |

          Unless, of course, you think transphobia itself to be a bullshit label.

          Of course that’s what she thinks. That’s how these people always try to weasel out of being called transphobic: “I can’t be transphobic, because there’s really no such thing as being trans! It’s a delusion!”

        6. Katniss
          Katniss February 5, 2013 at 9:16 pm |

          Your site contains transphobia. It is transphobic. Sorry, but thats a fact.

        7. dc
          dc February 5, 2013 at 9:18 pm |

          http://feministcurrent.com/category/transgenderism/
          ok:
          “Anybody can be absolutely anything if they simply say they are”: An interview with Sheila Jeffreys on transgenderism and feminism”

          from said article:

          So that was very destructive of feminism. You get conferences in the States now, I’ve seen them, women’s studies conferences, at which there are transgenders as the keynote speakers, which is kind of extraordinary because transgenderism is a symptom of a construction of a male dominant society which is enormously harmful both to those who travel under the idea that they are transgender, as well as to feminism and to women as a class.

          ok?
          end
          ‘derail’

        8. Donna L
          Donna L February 5, 2013 at 9:22 pm |

          http://feministcurrent.com/5039/anybody-can-be-absolutely-anything-if-they-simply-say-they-are-an-interview-with-sheila-jeffreys-on-transgenderism-and-feminism/

          some of the men who have transgendered – certainly not all, but some – have formed themselves into groups of fierce agitators and campaigners for their rights in opposition to the rights of women and feminists, and they organize to try and make sure that feminists speakers who are critical – and there are very few at this moment who are prepared to be critical openly because of the responses that they get – but they try to ensure that feminists who are critical do not get the space to speak.

          So for instance if they hear that a feminist who is critical is due to speak, such as myself or Germaine Greer who was critical in the 90s, or Janice Raymond who wrote The Transsexual Empire back in 1979, they will demand that the organizers remove those persons from their programmes and they will create campaigns to get the speakers removed. In relation to myself for instance, they’ve drawn up something on the net which is supposed to be all the dreadful things I’ve said about transgenderism – all of them, I think, are very sensible and not peculiar at all – but they put things together in a sort of propaganda sheet that they send out on the net and send it to those who organize conferences in order to try to pressure people into not permitting anybody who’s ever been critical to speak.

          Sure, not transphobic at all. Just the poor persecuted victims of “men who have transgendered.”

        9. Meghan Murphy
          Meghan Murphy February 5, 2013 at 9:25 pm |

          Good lord are you serious?? Is this really how you function in your day to day lives? Anytime a journalist interviews someone you don’t agree with do you start labeling them as various forms of ‘phobic’? What a joke. But convenient for you as you are spared from having to engage with actual arguments with any integrity or sincerity whatsoever.

        10. dc
          dc February 5, 2013 at 9:27 pm |

          [i guess we're all waiting on you now, Meghan]

        11. macavitykitsune
          macavitykitsune February 5, 2013 at 9:32 pm |

          But convenient for you as you are spared from having to engage with actual arguments with any integrity or sincerity whatsoever.

          Make one that isn’t just transphobic poo-flinging and we’ll address it, sweetie.

        12. macavitykitsune
          macavitykitsune February 5, 2013 at 9:34 pm |

          Anytime a journalist interviews someone you don’t agree with do you start labeling them as various forms of ‘phobic’?

          Also, wtf. If I gave a sympathetic interview to a white supremacist, I think people could call me racist, yes?

          It’s not the interviewing, it’s the falling all over yourself to agree with the vileness that Jeffreys spews.

        13. dc
          dc February 5, 2013 at 9:37 pm |

          [oops posts out of cinc]

          ok stupid q:
          do you agree with the interviewee?
          that’s kind of the crux.
          [no need to yell by the way]

        14. Meghan Murphy
          Meghan Murphy February 5, 2013 at 9:38 pm |

          In what universe is the article I wrote addressing the imaginary ‘war’ against sex workers ‘transphobic’?? This is some serious crazy-making y’all have gotten into.

        15. jemima101
          jemima101 February 6, 2013 at 3:13 am |

          It wasn’t, it did follow the same pattern of believing because you say something doesn’t exist, then it doesn’t.

          So how is being God treating you?

        16. dc
          dc February 5, 2013 at 9:42 pm |
        17. Donna L
          Donna L February 5, 2013 at 9:43 pm |

          Good lord are you serious?? Is this really how you function in your day to day lives? Anytime a journalist interviews someone you don’t agree with do you start labeling them as various forms of ‘phobic’? What a joke. But convenient for you as you are spared from having to engage with actual arguments with any integrity or sincerity whatsoever.

          You giving Jeffreys a platform for her repulsive screed makes you a journalist? Hilarious. Your whole fucking website shows that you agree with what she says. Not only are you a bigot, you’re a dishonest one.

          But this isn’t gendertrender or radfemhub. You don’t spout nonsense like that here and expect to be greeted by fawning sycophancy.

          And I’ll say it again: there are no “actual arguments” to engage with, any more than I’d engage with someone in the Phelps clan about whether they were homophobic. Every single one of the factual and historical assertions that Jeffreys makes about trans people has been refuted hundreds of times. But it makes no difference; people like her — and you, until proven otherwise — don’t listen, and simply continue to make the same stupid claims over and over again. No intelligent person should ever make the mistake of legitimizing these arguments by debating them.

        18. macavitykitsune
          macavitykitsune February 5, 2013 at 9:45 pm |

          In what universe is the article I wrote addressing the imaginary ‘war’ against sex workers ‘transphobic’??

          The SITE. Not that article. THE SITE. Goddamn, can’t you read? Such bullshit.

          Oh, except in an earlier comment you noted:

          Anytime a journalist interviews someone you don’t agree with do you start labeling them as various forms of ‘phobic’?

          So you clearly know we’re referencing the site in my and dc’s case, and the interview in Donna’s. Hence, disingenuous.

          And we’re not “labeling” you anything. If I felt like labeling you, my title of choice would be “a fucking disgrace to feminists”. Which would be as accurate as calling you a transphobe, but which has the advantage of having words you might actually understand.

        19. Meghan Murphy
          Meghan Murphy February 5, 2013 at 9:46 pm |

          Well, you all are very skilled at the derail. If only trolling were a profession! The point is that you use various ‘phobia’ labels in order to dismiss valid arguments and in order to excuse yourself from engaging with any integrity. I fail to see how this is productive. I see people do this time and time again. It’s a cop-out. You don’t like Sheila Jeffreys. Great. Move on. The article was addressing completely unrelated arguments.

        20. dc
          dc February 5, 2013 at 9:46 pm |

          hang on everyone maybe there is some confusion.
          so again:
          do you agree with the interviewee?
          that’s kind of the crux.

          ok Megan

        21. Donna L
          Donna L February 5, 2013 at 9:51 pm |

          http://feministcurrent.com/3130/radical-feminism-just-making-it-up-as-we-go-along/

          And here’s Ms. Murphy’s level of legitimate journalistic engagement with Sheila Jeffreys’ transphobia:

          She is a radical feminist through and through and she is a very kind woman.

        22. Meghan Murphy
          Meghan Murphy February 5, 2013 at 9:52 pm |

          I have zero interest in getting into some trans debate with any of you. You tried to dismiss the article I wrote addressing bullshit arguments made about feminists who are critical of the sex industry by calling my site transphobic. That’s the point. 1) the site isn’t ‘transphobic’, 2) engage with the actual arguments being made in the original article posted. This is why I posted initially. What an incredible waste of time this has been. GO FEMINISM!

        23. Donna L
          Donna L February 5, 2013 at 9:55 pm |

          dc, please leave it alone. You’re giving this person way too much credit. Of course she agrees with Sheila Jeffreys!

        24. Donna L
          Donna L February 5, 2013 at 10:01 pm |

          One last comment, using Ms. Murphy’s own words from the same comment thread at her site:

          “YOU don’t get to decide what radical feminism means.”

          By exactly the same token, SHE does not get to decide what transphobia means, or whether her site is transphobic. No matter how many times she says so.

          And she really doesn’t get it if she expects people to address only the subject of one article on her site, while ignoring the unsavory aspects of that site — any more than people should ignore it if she promoted racist, anti-Semitism, or homophobia elsewhere on her site.

        25. dc
          dc February 5, 2013 at 10:01 pm |

          hey donna.actually i really wanted her to answer that question.why not?
          if she agrees why not say so?
          that was kind of the point.

        26. Meghan Murphy
          Meghan Murphy February 5, 2013 at 10:07 pm |

          Whatever. Decide whatever you want so long as it allows you to avoid addressing feminist arguments in a rational or authentic way. You’re wasting your time, you’re wasting my time, and you’re contributing absolutely nothing to feminism.

        27. macavitykitsune
          macavitykitsune February 5, 2013 at 10:09 pm |

          Meghan,

          does transphobia exist or not, in your opinion? It’s a simple enough question and it’s been asked enough times that it should have sunk in. Yes or no?

        28. dc
          dc February 5, 2013 at 10:10 pm |

          not going to answer it eh?
          (well i guess Donna was right.
          i gave you the benefit of the doubt though Meg.)

        29. Meghan Murphy
          Meghan Murphy February 5, 2013 at 10:17 pm |

          No seriously, is ‘troll’ a full time gig? Y’all are good.

        30. macavitykitsune
          macavitykitsune February 5, 2013 at 10:19 pm |

          No seriously, is ‘troll’ a full time gig?

          I don’t know. Are you starving in a gutter?

          Yes or no, babycakes?

        31. Donna L
          Donna L February 5, 2013 at 10:23 pm |

          why not?

          Because her own website answers the question. Asking her to confirm or deny it is simply giving her an opportunity to weasel out of it, and insult everyone’s intelligence in the process. Would you engage with someone who published a completely uncritical, approving interview with a virulent misogynist, and talked about how “kind” they were? Would you give that person the benefit of the doubt?

          Even asking her if she believes that transphobia exists would simply allow her to say that it does but that she isn’t transphobic because she isn’t afraid of trans people, blah blah blah. Like the people who say “I’m not homophobic! Homosexuals don’t frighten me!”

        32. dc
          dc February 5, 2013 at 10:42 pm |

          DL,i respectfully disagree.
          i think macavity and i
          (not trolls, as we post here constantly Meg)
          did exactly the right thing by expecting Meghan
          to confirm her seeming anti trans bias.
          so.
          i guess that ends it for me though.
          i feel i found out what i presumed was the case.
          thanks for the discussion all, and cheers to fellow troll macavity.

          ps do you have a blog??(more derail, i guess…lol)

        33. dc
          dc February 5, 2013 at 10:46 pm |

          ps do you have a blog??
          (Macavity,i mean)

        34. macavitykitsune
          macavitykitsune February 5, 2013 at 10:56 pm |

          dc, I do! You can get to it by clicking on my name…. dunno how interesting you’d find it, though, lol. Is mostly random rantings and thoughts.

        35. dc
          dc February 5, 2013 at 10:59 pm |

          mostly random rantings and thoughts.

          oh my god i LOVE mostly random rantings and thoughts!
          *runs off to merrily click on link*

        36. LotusBecca
          LotusBecca February 6, 2013 at 2:15 am |

          Meghan, I’m sure you won’t like or agree with what I’m about to say, but here it goes.

          There’s a idea in the leftist anti-fascist movement called “no platform.” It basically means that hate groups–racist, anti-Semitic, and so on–are incredibly destructive; they don’t have valid arguments; and that therefore they should not be engaged with in any way–they should merely be denied an opportunity to spread their ideas to a mainstream audience whenever possible. I think a lot of people have a similar view toward people who advocate transphobia, as you do on your website. So I think people have specifically not been engaging with your arguments because they believe you arguments–being invalid and bigoted–don’t deserve the dignity of a counterargument. So the point isn’t to debate you and change your mind. The point is to persuade people here that they shouldn’t even give your website a chance or entertain your arguments.

          Perhaps you think this is inappropriate and that all arguments should be engaged with, but this is a standard practice among leftists toward things they regard as hate speech. And while obviously you don’t believe you are spreading hate speech, a lot of people here believe you are and are treating you accordingly.

        37. Meghan Murphy
          Meghan Murphy February 6, 2013 at 3:19 am |

          @macavitykitsune
          Are you serious with this ‘sweetie’ / ‘babycakes’ shit? Gross. Really.

        38. BobChaos23
          BobChaos23 February 6, 2013 at 8:53 am |

          Um, excuse me? All you have done, Meghan, is dismiss people who have offered perfectly valid arguments…why should anyone not treat you the same way you have insisted on treating myself and others who have tried to talk to you, been ignored, and only becamse nasty/sarcastic AFTER your disregard for their arguments?

          You are just another person who tbhinks they are right about everything and cannot tolerate dissent. Nice going, and good luck with that.

        39. SamLL
          SamLL February 6, 2013 at 9:13 am |

          LotusBecca, I really appreciate your “no platform” post, it was extremely cogent. Thank you.

        40. Katniss
          Katniss February 6, 2013 at 12:09 pm |

          Meghan for someone who is so preachy about people responding to you with “derails” you sure are great at avoiding giving us any response that acknowledges the well stated arguments about why your site is transphobic. It’s almost like you don’t have a good argument against how bigoted your site is!

        41. macavitykitsune
          macavitykitsune February 6, 2013 at 12:12 pm |

          Are you serious with this ‘sweetie’ / ‘babycakes’ shit? Gross. Really.

          About as serious as you are with your claim of being non-transphobic, sugarpuff.

        42. Meghan Murphy
          Meghan Murphy February 6, 2013 at 12:31 pm |

          Well, I can’t say I envy Feministe’s moderators. I’m glad you all are enjoying yourselves though! Bob the troll is here and so I’m out. You can waste each other’s time. Which is clearly something you enjoy immensely. This kind of ‘discourse’ is where feminism goes to die.

        43. martine votvik
          martine votvik February 6, 2013 at 12:33 pm |

          Being a troll is about the derailing, not about how popular you are in the thread. Calling a woman babycakes as a dismissal on a feminist website is absolutely vile and bigot. It is beyond me how that comment made it through moderation.

          Murphy wrote an excellent article that is absolutely relevant to this blogpost, there is so much fertile material for discussion and you waste space on scoring cheap points.

        44. macavitykitsune
          macavitykitsune February 6, 2013 at 12:34 pm |

          This kind of ‘discourse’ is where feminism goes to die.

          Jill, I believe you have a new tagline! “In defense of the sanctimonious feminist elephant graveyard set!”

        45. macavitykitsune
          macavitykitsune February 6, 2013 at 12:39 pm |

          Being a troll is about the derailing, not about how popular you are in the thread

          But I put on my short skirt and got the pompoms out and everything! D:

          Calling a woman babycakes as a dismissal on a feminist website is absolutely vile and bigot.

          It’s not nearly as vile as fawning all over a transphobic asshole like Sheila Jeffreys. Nor is it nearly as bigoted as asserting, all over a website, that trans women aren’t really women, and giving space and unqualified approval to people who have been known to recommend killing all trans women.

          Want to be taken seriously? Don’t fucking be a bigot. I wouldn’t bother to be nice to the Phelps clan or Geraldo “hoodie” Rivera, etc. Murphy doesn’t get special fuzzy treatment for being a woman.

          Also, maybe I’m just that extra bit offended because of the contact embarrassment of having a lesbian feminist be spouting this shit. You’ll forgive me, I’m sure.

        46. Li
          Li February 6, 2013 at 12:49 pm |

          there is so much fertile material for discussion and you waste space on scoring cheap points.

          Pointing out that someone’s website provides a platform for virulent transmisogyny is not a “cheap point”. A cheap point would be my agreeing with you as to how “fertile” Meghan’s opinions are.

        47. Meghan Murphy
          Meghan Murphy February 6, 2013 at 12:56 pm |

          On a side note, @macavitykitsune — you’re super creepy.

        48. macavitykitsune
          macavitykitsune February 6, 2013 at 1:02 pm |

          On a side note, @macavitykitsune — you’re super creepy.

          ^__^ I love that the opinions of someone who’s transphobic, and the opinions of someone else who wants all sex workers shot as “betrayers” of women, aren’t creepy. But my calling you babycakes on a feminist website is not merely creepy, but SUPER creepy. (Is that what happens when creepy gets bitten by a radioactive spider?) Your priorities fascinate me.

        49. macavitykitsune
          macavitykitsune February 6, 2013 at 1:06 pm |

          Also:

          On a side note

          Has there been a NON-side note? Because literally all you’ve done on this thread has been to waggle disapproving fingers at us and telling us to “engage”, while ignoring serious questions. I didn’t start pet-naming you until you demonstrated repeatedly that you had the time to chide us, but not to respond to us.

      5. Donna L
        Donna L February 6, 2013 at 1:04 pm |

        As further proof that Meghan Murphy is an incredibly disingenuous human being who can’t even own and admit her views about trans women when she’s not among her fellow radfems, here’s another thread on her website in which she gives another fawning interview, this time with someone from Vancouver Rape Relief, about “the value of women only space”:

        http://feministcurrent.com/5033/rape-relief-v-nixon-transphobia-and-the-value-of-women-only-space-an-interview-with-lee-lakeman/

        Note this example of asking tough questions:

        MM: As you know, some people, as a result of this specific case have accused Vancouver Rape Relief of being what they call “transphobic”. Can you respond to that?

        “What they call ‘transphobic.’” That’s journalism for you! Speaking of being delusional.

        Yes, some kinds of feminism do go to die here: the bitter, Stalinist, gender essentialist, obsessively trans-hating kind. Transphobia does exist, and your website is a platform for it. Fortunately, your views — and those of your de facto fellow travelers, the fundamentalist religious right — are on their way to being consigned to the ash heap of history.

        1. macavitykitsune
          macavitykitsune February 6, 2013 at 1:14 pm |

          Donna, you rock, have I recently mentioned?

      6. Donna L
        Donna L February 6, 2013 at 1:18 pm |

        As for Martine Votvik, I knew the name was familiar, and it turns out that she is the commenter who complained a year or so ago about the characterization of Janice Raymond, Julie Bindel and Sheila Jeffreys as having a “hateful agenda,” by saying that none of those women “deserve to be attributed with a hateful agenda when all they have done is critically investigate things“!

        Right, they’re all just “investigators.”

        1. martine votvik
          martine votvik February 6, 2013 at 1:40 pm |

          Yes, I did say that, and I’ll stand by it. There might be anger, frustration and a fair share of outrage in their writings, but hate? I don’t see it. And I don’t think all of the outrage is unfounded, no matter how hurtful it might be to some people.

        2. macavitykitsune
          macavitykitsune February 6, 2013 at 1:43 pm |

          There might be anger, frustration and a fair share of outrage in their writings, but hate? I don’t see it.

          If I said you were a hater of true femininity and a tool of the gynocracy and you just want to kill all men, you’d consider me hateful. These women have made similar statements about other women (trans women), so I consider them hateful, as does Donna. Does that make sense?

        3. martine votvik
          martine votvik February 6, 2013 at 1:46 pm |

          please link me to the relevant quote so I know what I might agree to.

        4. EG
          EG February 6, 2013 at 1:50 pm |

          Their statements promote and justify the mistreatment of trans women. That’s certainly close enough to “hateful” for me.

        5. Donna L
          Donna L February 6, 2013 at 1:52 pm |

          I think you just confirmed what everybody already knew. News bulletin: it is not up to you to proclaim that the disgusting anti-trans rhetoric spewed by these people isn’t hateful. It is not up to you to argue that calling trans women delusional and/or rapist tools of the patriarchy is simply justified outrage. You are not the target. You don’t get to characterize these women as brave truth-tellers proclaiming their outrage, and, hey, you have to break some eggs to make an omelet? You are simply and clearly an oppressor in this context, and your continued obtuseness simply demonstrates that you are out of touch with reality. Wake up. Open your eyes to actual people and their actual lives. Otherwise, go away, and return to your own foul corners of the Internet where you and your ilk can continue to make your excruciatingly stupid, paranoid assertions. As Becca so aptly pointed out, people like the ones named — and you, as their supporter — do not deserve a platform for your repulsive views.

        6. Donna L
          Donna L February 6, 2013 at 1:55 pm |

          Oh, and it is not my obligation to do your research for you, and be exposed yet again to the hateful, damaging rhetoric of the people in question. There are innumerable sources that detail their words. If you’re going to defend them, learn first what they actually said. That’s your job. Don’t you fucking dare put it on me or any other trans person.

        7. Donna L
          Donna L February 6, 2013 at 2:00 pm |

          But since you’re undoubtedly too damn lazy and self-satisfied to do the necessary work, here are two extremely famous statements from Janice Raymond’s book — two of hundreds of similar staements — all of which you should have been familiar with before you offered your fatuous defense of her and the others.

          http://zagria.blogspot.com/2010/04/janice-raymond-1943-feminist-professor.html

          1. “All transsexuals rape women’s bodies by reducing the real female form to an artefact, and appropriating this body for themselves. [...] Transsexuals merely cut off the most obvious means of invading women, so that they seem non-invasive”.

          2. “Transsexually constructed lesbian-feminists show yet another face of patriarchy. As the male-to-constructed-female transsexual exhibits the attempt to possess women in a bodily sense while acting out the images into which men have molded women, the male-to-constructed-female who claims to be a lesbian-feminist attempts to possess women at a deeper level, this time under the guise of challenging rather than conforming to the role and behavior of stereotyped femininity”.

          Fuck you for daring to defend her without knowing what she said.

        8. martine votvik
          martine votvik February 6, 2013 at 2:06 pm |

          It’s not my job to do research for you either, you know.

          You are completely in the right when you fear that this sort of writings will be used to discriminate and hurt transgendered people, I know that this happens.

          I still think that there is a validity in the research and discussion around it.

        9. Donna L
          Donna L February 6, 2013 at 2:07 pm |

          God, I hate people like you; the kind who may not dirty their hands by engaging in hateful rhetoric themselves, but defend it. The kind who wallow in theory that bears no relationship to people’s lives, and try to escape condemnation by pleading ignorance of the incredible damage they do. You have no idea how hellish it is for trans women who also happen to be feminists to spend their lives being exposed to this garbage when they try to participate in feminism.

        10. macavitykitsune
          macavitykitsune February 6, 2013 at 2:10 pm |

          I still think that there is a validity in the research and discussion around it.

          WHY? I mean no seriously WHY? Would you also think there’s “validity” in research that says that rape is pleasurable? How about research that says that women who don’t or can’t bear children aren’t really women? This is every bit that offensive.

        11. Li
          Li February 6, 2013 at 2:11 pm |

          You are completely in the right when you fear that this sort of writings will be used to discriminate and hurt transgendered people, I know that this happens.

          No. The writing itself discriminates and hurts transgendered people. When Shiela Jeffrey’s refers to trans* men as “surgical social climbers”, it’s not just neutral because she’s an academic and then used by other cissupremacists against trans* men, it’s cissupremacist itself.

        12. PeggyLuWho
          PeggyLuWho February 6, 2013 at 2:20 pm |

          I was aware that this kind of thinking exists, but I’ve never actually read it. ::shudder:: Fuck that shit.

        13. Donna L
          Donna L February 6, 2013 at 2:13 pm |

          It’s not my job to do research for you either, you know.

          Listen, you fucking moron, YOU DON’T HAVE TO DO RESEARCH FOR ME. I ALREADY KNOW ALL OF IT. You are the one who makes factual assertions without providing support, and demands that others disprove your unsupported contentions. Even now, you refuse to acknowledge that Janice Raymond’s words quoted above are themselves hateful; you acknowledge only that they will be “used” to “discriminate and hurt transgendered [sic] people.”

          You are no different from the supporters of so-called “scientific racism.” That’s all just investigation too, right? It’s science!

          You are not only hateful, but a coward.

        14. Caperton
          Caperton February 6, 2013 at 2:17 pm | *

          Martine, you don’t think research and discussion about the validity of people’s lives is hurtful? To the people whose lives are under discussion, and to everyone who lives in a world where the validity of people’s existence is a matter for debate?

          On your own site, you’re welcome to say and do what you please, but on this one I invite you to remember you’re dealing with people and not cells in a petri dish. I also invite you to remember that transphobic comments are grounds for banning, and that’s not limited to language.

        15. martine votvik
          martine votvik February 6, 2013 at 2:19 pm |

          ” I ALREADY KNOW ALL OF IT. ”

          Yeah… okay I think I’ll just tip toe out of this discussion for now.

        16. Jill
          Jill February 6, 2013 at 2:25 pm | *

          Please do.

        17. Donna L
          Donna L February 6, 2013 at 2:22 pm |

          I’m sitting here on the verge of an anxiety attack. I can’t do this anymore right now. This is my life, not an academic discussion. Why does this keep happening here?

        18. Donna L
          Donna L February 6, 2013 at 2:27 pm |

          Martine says:

          ” I ALREADY KNOW ALL OF IT. ”

          Yeah… okay I think I’ll just tip toe out of this discussion for now.

          Good riddance.

          As for your assumed stance of superiority, making fun of my assertion that I already know all of it — yes, I do. I’ve been continually assaulted with the words of transphobic feminism for more than 30 years now. I have little doubt that I’ve read every damn word about transness and trans women that those three women have ever written. So, yes, I do know all of it. Which is why people like you will never get anywhere arguing with people like me.

        19. PeggyLuWho
          PeggyLuWho February 6, 2013 at 2:31 pm |

          Big giant internet hugs, Donna.

        20. GallingGalla
          GallingGalla February 6, 2013 at 2:36 pm |

          I’m sitting here on the verge of an anxiety attack. I can’t do this anymore right now. This is my life, not an academic discussion. Why does this keep happening here?

          Hugs if you want them, Donna.

          I think this keeps happening because Feministe does not have a position of no platform for hate, or at least it’s not taken seriously or fully implemented.

          Look, I like Feministe, but when trans* folk and our allies are saying that commenters like Martine and Meghan Murphy are saying transphobic things, are providing a platform for hateful transphobes like Julie Burchill and praising their work – when trans* folk and allies are providing links to back up our claims? It’s time for Feministe to refuse to provide a platform for hate. It’s time to ban these people. Between the two of them, they have made dozens of hateful, disrespectful comments, and a lot of trans* folk – and especially trans* women – are hurting. Votvik and Murphy can go spew their transphobic and anti-sex-worker hatred somewhere else.

          This shit keeps on going down on Feministe. TERFs come in and made dozens of hurtful comments before mods will step in and put a stop to it. When will that change? It’s not like I expect Feministe mods to be familiar with every TERF out there, and I know that you can’t keep on top of every thread minute by minute, but when we trans* folk are TELLING YOU that these people are transphobic, why do you continue to give them a platform?

        21. macavitykitsune
          macavitykitsune February 6, 2013 at 2:45 pm |

          Look, I like Feministe, but when trans* folk and our allies are saying that commenters like Martine and Meghan Murphy are saying transphobic things, are providing a platform for hateful transphobes like Julie Burchill and praising their work – when trans* folk and allies are providing links to back up our claims? It’s time for Feministe to refuse to provide a platform for hate.

          Seconding this. I know you’re all trans-friendly feminists (you being the moderators/bloggers), and I know it’s work, but Feministe has kind of a shoddy track record at this point re: transphobic trolls. I love this site, I love this community, and I’d really like to have some concrete and consistent zero-tolerance anti-transphobic policy to point to when telling trolls to fuck off.

          And maybe an anti-homophobia one just so I don’t have to spend ANOTHER fucking thread telling people that working against marriage equality is homophobic. That would be lovely too.

        22. Donna L
          Donna L February 6, 2013 at 2:55 pm |

          Well, they already tried to do that, by automatically sending all comments using the word “trans” into moderation. Obviously, that didn’t work. I’m not sure what would. Maybe placing more prominently at the top of the website something about the kinds of discourse that aren’t acceptable here, including racism, homophobia, and transphobia? (But don’t forget that every single one of these people insists that they aren’t transphobic. Whether because there’s no such thing, or because they don’t “fear” trans people, or because they’re just in favor of “investigating” the “facts,” or a million other excuses. So I’m not sure how much a prominent policy statement would deter them.)

      7. Donna L
        Donna L February 6, 2013 at 2:48 pm |

        Thank you, Peggy and Galla. Hugs accepted! I had major oral surgery yesterday afternoon because of what turned out to be a huge infection under one of my teeth that had eaten away the bone all the way down to the nerve — all of which I’d managed to ignore for the last 8 months in the hope that it would just go away! — and it still hurts so much today that I wasn’t able to go into work, and I haven’t been able to eat anything for the last 36 hours. So this is not what I expected to be doing today!

        1. macavitykitsune
          macavitykitsune February 6, 2013 at 3:00 pm |

          omg. Big hugs. I hope you get better soon…

        2. Li
          Li February 6, 2013 at 3:10 pm |

          Hugs for Donna!

          And ouch. Can you eat icecream or sorbet? You should totally take the opportunity to eat those things when you are able. Jelly is also excellent, but it is very tough to find good vegan jelly and non-vegan jelly is obviously not an option for you…

        3. GallingGalla
          GallingGalla February 6, 2013 at 7:44 pm |

          Ouch. Get better soon, Donna.

        4. Donna L
          Donna L February 6, 2013 at 8:55 pm |

          Thank you! I managed to get myself out of my apartment this afternoon to get my prescriptions for antibiotics and vicodin filled. And bought some ice cream while I was at it. Vicodin and ice cream make for a very pleasant evening.

        5. jemima101
          jemima101 February 6, 2013 at 9:01 pm |

          Ohhh now that sounds like a good night :)

          Seriously hope you are ok and not in too much pain.

        6. Ismone
          Ismone February 7, 2013 at 5:10 pm |

          DonnaL,

          Holy crap, that stuff was really, really vile. I cannot even. I cannot think of how someone could think that was true–and for Martine to act like there was rational “study” to be had?

          That woman’s dreadful screed didn’t contain any ideas, merely anatomical and psychological impossibilities masquerading as intellectualism.

          Jesus Christ on a cracker.

  1. Cade DeBois (@lifepostepic)
    Cade DeBois (@lifepostepic) February 5, 2013 at 1:49 pm |

    Er.

    Yeah, this is all kind hard for me to get behind. Sex slavery, child prostitution and women resorting to/being forced into prostitution due to being socially and economically trapped or vulnerable are real, world-wide issues and are things that we really ought to oppose, and these all fall under “sex trafficking” too. I don’t know who these feminists are who are allegedly singling out sex workers who do not fall under one of the above issues and are crafty and sneaky enough to use it to uphold everything a feminist ought to oppose, because they aren’t any feminist I know.

    I would appreciate it, if people who are your side of this issue really want to me to believe (and I am trying, in good faith) this is as serious of an issue without it coming across like you’re asking me to ignore how many girls and boys will be sold into sex slavery today because their families are that desperate, that they would come up with much more precise vocabulary and do much less pitting “good” feminists” against whatever feminist you disapprove of today.

    I get it, I’m a creeping-into-middle-age feminist, I have been listening to colored, queer and trans voices since I was in college, I know there are some ideas held by some feminists that aren’t as enlightened as we all would like. But when you start acting like THOSE FEMINISTS OVER THERE aren’t kosher, you’re probably going to lose me, cos I’m old enough to know that game too.

    1. Athenia
      Athenia February 5, 2013 at 2:55 pm |

      Yeah, when I hear that places like Iceland have to get foreign sex workers due to a variety of factors, I’m reminded that sex work isn’t just sex work.

      1. martine votvik
        martine votvik February 6, 2013 at 12:38 pm |

        I’m not sure if I understand your comment. Buying sex is outlawed in Iceland, and so is stripping.

        1. Athenia
          Athenia February 8, 2013 at 3:08 pm |

          Crap, maybe it wasn’t Iceland–although a quick google search says Iceland banned stripping in 2010. So, it’s possibly the article read was in reference to pre-2010.

        2. jemima101
          jemima101 February 8, 2013 at 3:21 pm |

          And this is why I can end up getting angry. When it comes to sex work feelings, half remembered stats and outright lies are apparently a basis for forming policy. Everyone has an opinion, very few people are willing to do any research.

    2. jemima101
      jemima101 February 5, 2013 at 3:00 pm |

      Ahhh we have to educate you out of your prejudices, forgive me while I look up Lourdes, intersectonality and why white cis middle class women should get of their backsides and educate themselves…

      Cos yeah, i exist to educate you…

      1. macavitykitsune
        macavitykitsune February 5, 2013 at 4:56 pm |

        No shit! I mean fucking seriously, I’m not a sex worker, nobody I know is a sex worker, I probably won’t engage in sex work ever in my life, and I can still somehow scrounge up the empathy and the two whole braincells needed to produce the thought “maybe listening to lived experience is a good thing”.

        1. karak
          karak February 6, 2013 at 11:42 am |

          I have to say the experience of a sex worker that chooses the industry compared to a trafficked woman is like asking a McDonalds worker what it feels like to be an undocumented immigrant forced into working for agribusiness.

          They both work in the same kind of business, but one of these things is really not like the other.

    3. Catie
      Catie February 5, 2013 at 3:04 pm |

      I guess I just had a very different take away from this article. I didn’t read the article so much as arguing that sex trafficking is nothing to worry about, but rather that the imprisonment of sex workers in the name of feminism is a highly problematic practice that does little to illuminate the experiences of sex workers, or help women leave sex work.

    4. Henry
      Henry February 5, 2013 at 4:01 pm |

      The part where Steinem advocates ending HIV prevention work – read that part. Everyone deserves health care whether they be slaves or not – scratch that – everyone deserves health care – you don’t need analysis or to understand anything about sex work/slavery/trafficking to get behind that. Gloria is officially on my bad humans list. Ditto for arresting the victim. Arrest the pimps, madams and customers if you want to run an anti-prostitution campaign – they are the ones abusing the prostitutes.

      1. Kes
        Kes February 7, 2013 at 12:00 pm |

        The article was misleading when it wrote that, though. It seemed weird to me, and a very quick Google search revealed was that what she ACTUALLY advocated was no longer having those programs be managed by the brothel-owners, and having the brothel-owners be paid a salary for their management.

        In other words, she didn’t say the programs should be eliminated. She just didn’t think that people who might well be pimps should get paid for the running of them.

        That wasn’t the only totally disingenuous thing in the article, either.

    5. macavitykitsune
      macavitykitsune February 5, 2013 at 4:53 pm |

      aren’t kosher

      How nice for you that your life is so cushy, and your morals so eroded, that you can dismiss calling people out for calling for the systematic rape/imprisonment of a subset of women as some sort of trivial wankfest. You’re an adorable cis straight white lady, yes you are, yes you are!

    6. dc
      dc February 5, 2013 at 7:44 pm |
    7. LotusBecca
      LotusBecca February 6, 2013 at 2:31 am |

      It’s not just feminists, although feminists are a part of it. It’s anyone who supports sex work being illegal (or sex work being semi-illegal a la the Swedish model) as well as anyone whose rhetoric feeds into toxic scripts that stigmatize and dehumanize sex workers. This includes feminists, centrists, conservatives–all sorts of people. And it’s a problem because sex workers are 16 times more likely to be murdered than women as a whole. They are more likely to die of AIDS. They are more likely to live in poverty, to spend time in prison. And so on. A lot of us want to stand in solidarity with these women and help them cast off these oppressions. That’s why we advocate legalizing and unionizing sex work and erasing the stigma attached to it–because that’s what sex workers are saying they want themselves for their liberation. These are oppressed women; that’s why you should care. That’s why you should oppose fair-weather feminists who are adding to the oppression of sex workers. And working on this issue is complementary (not opposed) to working on the issue of helping other women and children who are victims of sexual abuse, which is obviously a concern to you.

      1. wanttobeanon
        wanttobeanon February 6, 2013 at 9:56 am |

        Beautifully said.

      2. martine votvik
        martine votvik February 6, 2013 at 12:45 pm |

        “because that’s what sex workers are saying they want themselves for their liberation”

        I must have missed the conference of all sex workers where they put out that memo…

        1. LotusBecca
          LotusBecca February 6, 2013 at 3:10 pm |

          Yes, Martine. You’ve been missing all the conferences, actually.

      3. Au Contraire
        Au Contraire February 6, 2013 at 2:27 pm |

        Thank you for this comment. This is not an issue I know a lot about, and what you said was very clarifying for me.

  2. jemima101
    jemima101 February 5, 2013 at 1:56 pm |

    Thank you so much for this.
    Currently a post is doing the rounds claiming sex workers are just wrong to believe anti sex work feminists are anti sex workers. Quite a few feminists I know have passed it on, saying of course they are not anti me, I am nice, they just care about all the other sex workers so much!

    If white people denied racism, or straight people homophobia we would be up in arms, but non sex workers seem to think it is fine to tell sex workers what oppresses them.

    1. LotusBecca
      LotusBecca February 6, 2013 at 4:26 am |

      Jemima, I just want to thank you for taking your time to add so many passionate, thoughtful contributions to this thread. You’re right that non-sex workers (me, the radfems, all of us) have no clue what oppresses sex workers unless we listen to you all with an open mind and an open heart. And I’m appalled that more people aren’t willing to listen in this way, and I’m sorry you’ve had to deal with such bigoted and ignorant people here on Feministe and elsewhere. As a trans woman, I’m familiar with the phenomenon of people claiming they are helping you while they are in the midst of oppressing you, and it certainly sucks. Anyway, good luck in your struggle and remember that there are feminists like me supporting your efforts to legalize your trade and improve your working conditions.

      1. jemima101
        jemima101 February 6, 2013 at 6:52 am |

        Oh wow…a am close to tears reading that thank you.

      2. PeggyLuWho
        PeggyLuWho February 6, 2013 at 11:38 am |

        I second this, Jemima. Thanks for sharing.

    2. (BFing)Sarah
      (BFing)Sarah February 6, 2013 at 6:43 pm |

      No. No. NO. This is not the same thing as white people denying racism or straight people denying homophobia. I do not oppose the legalization of sex work, but please do not mix up you being hated on by feminists for your CHOSEN profession with people of color being hated on for being BORN a person of color. Not the fucking same and I am so sick to DEATH of sites like Feministe for not ever having a single fucking person say a word about all the subtle racism on this site. You have admitted to choosing your profession and that this results in nastiness and prejudice from others, I am sorry. But this is not the same thing as worrying that someone will shoot your child in the street just because he is “threatening” due to his color. No. It is not. This is the reason why so many WOC have abandoned this site.

      1. jemima101
        jemima101 February 6, 2013 at 6:53 pm |

        I am sorry you feel I was appropriating, however it is Woc and trans* women who due the parralells for me.

        Perhaps it is best that I simply say that I hope the mods read this and listen to your words about listening more to WoC

      2. LotusBecca
        LotusBecca February 6, 2013 at 8:25 pm |

        Jemima made an analogy. She didn’t say racism and prejudice against sex workers were the same.

        Oppression is very bad. Oppression doesn’t become more OK simply because the people being oppressed made the wrong “choice” People choose what religion they affiliate themselves with. That doesn’t mean it’s OK to oppress people on the basis of their religion (or lack thereof). People don’t choose to be LGBT, but they do usually choose whether or not to come out of the closet as LGBT. But it’s definitely not OK to oppress people just because they are open about the fact they’re queer.

        The purpose of Jemima’s analogy was to illustrate that it’s wrong for oppressors to lecture the people they are oppressing about the nature of said oppression. And the analogy was valid. That sort of ‘splaining shouldn’t happen, regardless of the pretext the oppressors give for their domination (whether it’s “you’re inherently inferior” or “you made the wrong choice.”)

        1. jemima101
          jemima101 February 6, 2013 at 8:50 pm |

          I thought I did, however part of being willing to listen is that you are willing to accept that others did not hear what you intended.

          I dont really want to make others feel that their pain is being ignored, I simply see similarities in behavior, and think it is worth pointing it out, as I genuinely believe there is a common enemy.

  3. karak
    karak February 5, 2013 at 2:31 pm |

    I don’t want to criminalize and punish women because they work in sex work. But I’ve rarely heard of sex work that wasn’t based in poverty, or addiction, or coercion (physical or financial). I know very well there are the Heidi Fleiss type sex workers, who genuinely seem to enjoy the trade, but that’s not most workers and most women.

    Sex work is inherently dangerous–you’re alone, you’re vulnerable, often with a partner equal or larger in size, you run risks of STDs and normal complications of sex, like UTIs, and the very dangerous culture of stigma around sex puts you at risk of all kinds of abuse and violence.

    I work food service. We tell our delivery drivers that they are under NO CIRCUMSTANCES to enter a person’s home, to go to a location other than the stated address, to meet people at anything other than an established, inhabited building/business, or carry more than $20 on their person. Soulless corporate America believes that a fully dressed man with his own vehicle is in too much danger delivering a pizza in broad daylight at a public park. How much danger is a sex worker in then?

    I put sex workers right up there with miners (coal, diamond, whatever) in the category of Jobs That Shouldn’t Exist Ever. Going into a poisonous cave to peel out natural resources is not something someone should ever be forced to do, or forced by “life circumstances”. Spelunkers, however, do pretty much just that for fun. The fact that I want mining to die out as a career doesn’t mean I hate spelunkers, and if spelunkers get caught up in legislation about mining, that does suck but it’s not the greater tragedy.

    I like your post. I completely agree that, in trying to deal with sex work, policies and procedures have cropped up that are unhelpful and downright detrimental. I agree there seems to a be a lot of radically different ideas and approaches by people who call themselves feminists, allying with other people who are decidedly not feminist. But I believe, at worst, they’re being unhelpful and continuing the old system; it’s not getting worse.

    1. Kasabian
      Kasabian February 5, 2013 at 2:42 pm |

      I don’t know if you lend too much credence to the theory that prostitution has been and continues to be a necessary and vital part of human society, and all we can do is try to minimize the negative effects, but I thought I’d at least bring it up.

      I sure as shit don’t want anyone to have to dig for diamonds, but if coal’s what keeps the lights on…? (metaphorically speaking)

      1. karak
        karak February 5, 2013 at 3:32 pm |

        I kind of do, kind of don’t.

        Sex is something most humans desire, and will trade to get trade–trade affection, love, money, orgasms, whatever.

        Let me compare it to food–I think we’re always going to trade/buy food, but that doesn’t mean I think that exploitative and abusive agricultural practices are unavoidable and can only be mitigated.

        I want sex for money to be a completely free choice, like eating a bag of candy–something you just want to do because you like it, not because you don’t have any other food in the house and you’re too poor to afford vegetables.

        1. wembley
          wembley February 6, 2013 at 10:13 am |

          +1,000. Disclaimer: I love organizations like HIPS, etc. I think sex work (sex for money, stripping, porn, etc.) should be unionized, etc. Lol, never gonna happen, would also like a unicorn and so on, but yeah. Like you, I would like the exchange of sex for money to some day be something that only exists as something freely chosen and just for kicks.

          That said (I know, I knowwww) (also TRIGGER WARNING for mention of rape below), I get leery of conversations about sex work in the feminist-o-sphere because… like, the history of the discussion of this stuff on the internet has felt a little like this to me:

          Anti-Sex Work Radfems/Feminists: ALL SEX WORK IS EXPLOITATIVE, MISOGYNIST AND TERRIBLE. ALL SEX WORKERS AND PORN ACTRESSES GET INTO IT BECAUSE OF TRAUMA AND ARE FURTHER TRAUMATIZED.

          “Spelunker” Sex Worker: I’m not traumatized, I love it and it’s awesome!

          Porn Actress That Might Be Saying This Because It’s True Or Might Be Saying This Because She Doesn’t Wanna Get Fired: Ditto!

          Rest Of Non-Sex Worker Feminists: LOOK, SHE SAID IT WAS AWESOME, OKAY, SHUT UP RADFEMS. THEY’RE SPELUNKIN’.

          Sex Workers: Also, here are a lot of good points about how criminalization really hurts us and doesn’t help at all and could you please take our voices into account when it comes to dealing with our lives and work.

          Rest Of Non-Sex Worker Feminists: *ingests those really good points*

          Radfems: BLARGL NOT BUYIN’ IT

          Cops, Politicians, Etc.: BLARGL CRIMINALIZATION, BRB BUSY RUINING YOUR LIVES BLARGL.

          Rest Of Non-Sex Worker Feminists: Leave them alone, okay, and because I’m so sick of your shit, I’m going to make the argument that the abuses happening at this job happen but so do abuses at McDonald’s, Walmart, etc.

          Sex Workers: *getting raped and murdered*

          McDonald’s Workers: *getting sexually harassed which is terrible but not getting raped and murdered as a matter of course by their customers or bosses*

          Overlap Between Trafficking & Non-Trafficked Sex Work: *not getting mentioned*

          The Fact That Most Sex Workers Aren’t Spelunkers: *not really the central thrust of most of these conversations*

          Maybe this will be seen as a derail, maybe people will see this as an unfair read of The Broader Sex Work Discussion In The Blogosphere Over The Years, maybe this won’t even come out of mod because it’s a fucked up opinion to have, but I just want to say, I am far from an internet radfem, I believe in decriminalization, I believe in unionization, but… yeah, this is sort of how this discussion — not just this post, but the meta-discussion over the years — has felt to me.

        2. jemima101
          jemima101 February 6, 2013 at 10:44 am |

          I cannot say how many ways I love this comment. The way out of course is simple, listen to sex woerkers, the ones who are happy, the ones who are raped, the ones who want to leave but can’t because they have records, the ones with substance misuse issues, the ones who cant work in twos cos thats illegal, the ones who want to share their stories of abuse but cannot because it is leapt on as a reason to take away theri income.

          One point though, there are sex workers unions, they are awesome, especially in Asia and the Pacific where they are responsible for real change. Of course that would mean listening to the voices of WoC and we know how great rad fems are at that.

        3. martine votvik
          martine votvik February 6, 2013 at 1:08 pm |

          wembley

          I like your analysis and I think it is very abt and relevant, but I think it misses out on one important rad-fem perspective.

          We radical feminist will also say. “Could we please also have a discussion about the ethics of the choice of the punter plz?”

          I’ve never met a so called pro-sex-worker-feminist who was willing to engage with this beyond individual choice and responsibility. I think that it is a real problem that we live in a culture where a lot of men think they have a right to purchase sex as a commodity. A culture where some men regularly frequent prostitutes who they know are doing it under some form of duress or force.

          Why is it so dangerous to discuss what legalizing sex work might do to engorge that entitlement? And how that might damage our society further?

        4. macavitykitsune
          macavitykitsune February 6, 2013 at 1:13 pm |

          We radical feminist will also say. “Could we please also have a discussion about the ethics of the choice of the punter plz?”

          And that’s a good and relevant discussion IMO.

          I’ve never met a so called pro-sex-worker-feminist who was willing to engage with this beyond individual choice and responsibility.

          So I guess you’ve met one now. Would you like to discuss it? I’d love to have a productive, non-transphobic discussion on the matter with a radical feminist.

        5. martine votvik
          martine votvik February 6, 2013 at 1:17 pm |

          wembley

          and I also miss the whole discussion on how it might be a bad idea to normalize sex as a purchasable commodity.

          I’ve yet to see any pro-sex-worker-feminists willing to have a serious discussion on how that might impact society long term.

        6. martine votvik
          martine votvik February 6, 2013 at 1:19 pm |

          macavitykitsune

          oh boy, oh boy! Could it even be one that goes beyond individual instances?

        7. macavitykitsune
          macavitykitsune February 6, 2013 at 1:34 pm |

          oh boy, oh boy! Could it even be one that goes beyond individual instances?

          I think that the way sex is commodified today is incredibly problematic. I don’t think the solution is to call sex workers who say they chose the trade Kool-aid drinking brainwashed whateveryourinsultofchoiceis, like people have been doing on this thread. That doesn’t mean I don’t have capital-o Opinions on how johns work/think/feel entitled to act. If they WEREN’T entitled fucknuts, if they didn’t feel entitled to sex workers’ bodies and even their consent, then sex workers would be getting raped/abused/murdered at exactly the same rates as people everywhere. This is clearly not the case.

          I think that, in a world without the patriarchy, sex work would be no threat to anyone and completely value-neutral and no more of a Big Deal than, say, hiring a pro tennis player to play with you on Sunday mornings, or getting a massage. As with most “world without the patriarchy” statements, I don’t think this is the case. I totally believe sex workers when they say they choose to do sex work; I would not believe the vast majority of clients who say they’re making a totally egalitarian non-entitled non-patriarchal decision. Does that make sense?

      2. martine votvik
        martine votvik February 6, 2013 at 1:42 pm |

        ;,,,(

        but we were going to talk about the menz, you promised :(

      3. martine votvik
        martine votvik February 6, 2013 at 1:44 pm |

        woops that was ment for macavitykitsune

        saying:
        “I don’t think the solution is to call sex workers…”

        1. macavitykitsune
          macavitykitsune February 6, 2013 at 1:47 pm |

          Did you miss where I did that? Talked about johns?

          …does being a radfem actually interfere with one’s ability to read? I’m beginning to worry.

    2. Li
      Li February 5, 2013 at 2:44 pm |

      I know very well there are the Heidi Fleiss type sex workers, who genuinely seem to enjoy the trade, but that’s not most workers and most women.

      Yeah, I live in New South Wales, where sex work is decriminalised, and frankly I know a lot of sex workers and ex sex workers in both NSW and other parts of Australia and while they have shit days at work like everyone else my experience is that most of them have a generally positive view of their jobs. So, like, citation needed.

      And yes, I think any job where you work alone with people is is risky. But we don’t make these kinds of patronising arguments about nurses, for example, even though they’re also pretty exposed to sexual violence (and yes, I am hearing this all in the voice of a close friend of mine who has done both sex work and nursing work).

      1. karak
        karak February 5, 2013 at 3:47 pm |

        I’ve worked as a caregiver. At one of my old jobs, a juvenile client beat me somewhat badly–ripped out my hair, bruised up my face, dislocated the cartilage in my nose. I went back to work because I loved my job, and the only reason I’m still not there getting the crap kicked out of me is that the department got shut down.

        So, I get loving a dangerous job, for whatever reasons make sense to you.

        Nurses and caregivers have two things on their side, though: they wield enormous power over their clients, and they can appeal to socially acceptable paradigms of being martyrs, healers, and “angels” if they need help. (I get some sex workers also can also wield this level of power, but not as consistently or directly, I feel.)

    3. jemima101
      jemima101 February 5, 2013 at 3:01 pm |

      Read more…we exist even if some feminists deny it

      1. karak
        karak February 5, 2013 at 3:48 pm |

        I do not think you make up the majority of the sex work industry.

        1. jemima101
          jemima101 February 5, 2013 at 3:59 pm |

          http://www.feminisnt.com/2010/want-to-play-bingo-with-the-antis/

          Nope I am not representative, I do a;most have a full house tho.

      2. karak
        karak February 6, 2013 at 11:48 am |

        I also want to add something: I don’t sex work should be a crime.

        I think that unions, organizations *of* sex workers *by* sex workers should be the norm, and I think people who frequent coerced or non-union sex workers should be the ones going to prison and getting convicted.

    4. LotusBecca
      LotusBecca February 6, 2013 at 2:47 am |

      You know, I don’t want sex work to exist either. I don’t want any work to exist. I don’t want money to exist, and I want all people to have their basic needs for food, shelter, clothing, medical care, education, and cultural enrichment guaranteed–so people will engage in sex (and every other human activity) purely because they feel like it and want to enrich the lives of those around them.

      But in a capitalist economy, most people need a job. Many of the other jobs women have available to them are shit also. The women who choose sex work choose it for a thought-out reason. Some do so because they find it genuinely fulfilling, most do so because it’s the best of several shitty options that are available to them–just as the rest of the working class chooses their field of employment. And yes, of course, it’s dangerous. Sex workers are 16 times more likely to be murdered than women in general. That’s all the more evidence that people who aren’t sex workers need to get our act together and ensure that sex workers stop being oppressed, that the stigmatization of them and criminalization of them and their customers ends.

      1. karak
        karak February 6, 2013 at 11:51 am |

        I’d rather focus on offering safety while they’re in the industry and focus on giving them realistic job options, training, and filling the holes in their resume.

        I’m very American in the sense that I believe everyone should work, at whatever level they’re capable of working–both for their own mental well-being and the good of society in general. But I don’t believe you should ever have to work a job where being murdered and no one giving a shit is part of the job description.

        1. LotusBecca
          LotusBecca February 6, 2013 at 3:21 pm |

          Fair enough. In my opinion, though, sex workers will continue to be sex workers and will continue to be murdered and oppressed so long as both capitalism and patriarchy exist. It’s not possible to dismantle patriarchy without dismantling capitalism. So all the programs you suggest are good and helpful, of course, but I don’t think they go nearly far enough in liberating sex workers.

  4. Kasabian
    Kasabian February 5, 2013 at 2:33 pm |

    It sounds like what’s happening, and I could be completely wrong, is that activists howl for bigger crackdowns on sex trafficking and it gets interpreted down on the streets as “arrest more sex workers” rather than “arrest those who abuse and exploit sex workers.”

    It seems like we need to scream louder that it’s the pimps and abusers, not the sex workers that need to be in jail.

    1. Li
      Li February 5, 2013 at 2:50 pm |

      What exactly do activists expect to happen when they call for greater police intervention into sex work? Because here’s the thing, the “people who abuse and exploit sex workers”, they are very very often cops. Frankly, if people think police should be anywhere near sex workers except on a worker’s own decision, then I do not think they have enough of an understanding of the kinds of violence and harassment faced by sex workers for me to want them anywhere near policy making.

      1. Kasabian
        Kasabian February 5, 2013 at 3:09 pm |

        Good point. It’s incredibly naive to ask for more police intervention and expect positive results. Frankly, I am of the opinion that legalization /decriminalization is the only really positive option.

        But if you’re going to be screaming at the cops for action, you might as well be screaming for the right things.

      2. Anon21
        Anon21 February 5, 2013 at 3:14 pm |

        So does that imply that there’s nothing that can or should be done in the law enforcement and prosecutorial sphere to combat sex trafficking? I know some people who have done some interesting work on educating and informing police about sex trafficking issues and how to recognize subtle signs of coercion. But I guess if police are intentionally harming sex workers, education of that kind isn’t likely to work, in your view; the problem is bad motives, not ignorance.

        1. Catie
          Catie February 5, 2013 at 3:36 pm |

          I think one of the biggest problems with this kind of approach is that it fails to really recognize the trauma that these women potentially face. Trauma is not just about the event but everything that comes after the event, including things like how police and family treat you. And police rarely have a good track record for helping victims heal.

          This is why think that feminist energy could be better spent creating a “right to exist” (i.e. organizations that help women who what to leave sex work leave). I feel this kind of an organization is better positioned to help women receive care and support. Although, I think it’s important that these kinds of organizations don’t bully women in to leaving.

        2. Kasabian
          Kasabian February 5, 2013 at 3:53 pm |

          I’ll point out (though it might be obvious) that none of this is a zero-sum game. We don’t have to just educate cops or push for decriminalization or just support ‘right to exist’ organizations.

        3. Li
          Li February 5, 2013 at 3:56 pm |

          But I guess if police are intentionally harming sex workers, education of that kind isn’t likely to work, in your view; the problem is bad motives, not ignorance.

          Ok, so for a contextual example, I read these two sentences last night in the book I’m reading, Queer (In)Justice.

          “[a] 2002 Chicago-based study of women in the sex trades found that 30 percent of erotic dancers and 24 percent of street-based sex workers who had been raped identified a police officer as the rapist. Approximately 20 percent of other acts of sexual violence reported by study participants were committed by police.”

          Now, that, I don’t think it needs to be said, is a pretty fucking appalling set of statistics. And it means that one of my question with regards to any project that involves police and sex workers is “Is the project able to be manipulated by rapist police officers in order to provide cover for their own activities or to coerce sex workers in any way?”

          I don’t think that no one should ever works with cops ever and that they’re all irredeemably evil. But I do think that projects that work with cops need to have very very thought out strategies on how they will deal with the fact that there are a massive number of scumbag abusers who opportunistically prey on vulnerable women, especially sex workers or categories of women they can get away with profiling as sex workers (ie. trans women of colour).

        4. Donna L
          Donna L February 5, 2013 at 9:28 pm |

          categories of women they can get away with profiling as sex workers (ie. trans women of colour).

          But don’t forget, a lot of the most prominent “abolitionists” and anti-sex work activists don’t concern themselves with trans women — because, as I once read one of them explain, male prostitution [sic] is not within their purview.

    2. Lindsay Beyerstein
      Lindsay Beyerstein February 5, 2013 at 3:04 pm |

      The anti-trafficking crowd is a strange assortment of people. You’ve got law and order conservatives like John Ashcroft making common cause with feminists like Melissa Farley and neo-liberals like Nick Kristof. It doesn’t surprise me that these folks unite to form the Gang Who Can’t Shoot Straight.

      1. Donna L
        Donna L February 5, 2013 at 9:29 pm |

        Don’t forget the transphobes!

      2. Natalia
        Natalia February 6, 2013 at 2:00 pm |

        Yes. Unfortunately.

    3. Henry
      Henry February 5, 2013 at 4:12 pm |

      it takes more work to arrest customers than it does street prostitutes. customers also are more likely to fight the charges. the cops know where the hookers are, the order comes down, they send some undercover guys to buy sex, they get their bust, the hookers plead out and are back on the street few months later at some other less visible location. I remember in NYC when you men got propositioned on 7th avenue walking by penn station, then it was only the 8th avenue entrance, and now wherever the cops moved them.

      to bust johns you have to put cops out on the street or in a motel, place ads and wait for a customer to show up, then they get a lawyer and fight the charges because they are just upstanding citizens with a taste for slave provided massages with happy endings.

      1. Kasabian
        Kasabian February 5, 2013 at 7:03 pm |

        I imagine arresting actual pimps and traffickers is harder still. Hardly justifies taking the easy way out, but at least it makes more sense in a very cynical way.

    4. konkonsn
      konkonsn February 5, 2013 at 8:01 pm |

      I think the article made a very strong point that this isn’t about laws being misinterpreted after they’re passed (although that is happening) but about anti-sex feminists reworking terms like prostitution and sex work into anti-trafficking rhetoric so they can get the same laws passed but with more support. It’s not about feminists with good intentions having their words twisted; they’re doing the initial twisting.

  5. Athenia
    Athenia February 5, 2013 at 2:39 pm |

    The anti-trafficking activists refuse to listen to sex workers tell their stories:

    Oversimplified portrayals of trafficking can have devastating consequences for those who are trafficked. “When I am vacating prior convictions for survivors,” says [Melissa] Broudo [of the Urban Justice Center], “I view it as a legal hurdle if it’s someone who isn’t a cisgender [nontransgender] female minor at the time. And it shouldn’t be that way.”

    I find this quote interesting– if we are fighting to protect the rights of sex workers how in heavens are we going to do this without legalization of sex work? And if we legalize sex work, how is that going to prevent sex trafficking of anyone–minor or no?

    1. Kasabian
      Kasabian February 5, 2013 at 2:55 pm |

      See Drahill’s comment below. You can legalize consensual sex-work and keep non-consensual sex trafficking illegal.

    2. Li
      Li February 5, 2013 at 2:59 pm |

      Short answer: legalisation enables people to better engage in what I think is a major barrier against many sorts of exploitative practices, and that’s industrial and labour organising.

    3. Drahill
      Drahill February 5, 2013 at 3:02 pm |

      It’s about the consent issue. Plenty of sex workers are independent and working because they want to (we can set aside the whole poverty and economic pressure issue for another day). Sex trafficking refers to something very specific – when a third party (pimp, whoever) uses coercion or force to make a woman do sex work when she doesn’t want to. The problem now is that sex work’s illegality creates an environment that is extremely hospitable to trafficking – because women are less likely to go to the police, report their abusers or seek any kind of help.

      There is an inherent tension in how to help sex workers, because most feminists rightly see the traffickers as repugnant. However, sometimes, trafficking victims have good reasons to not leave, so the question then becomes how to best help the victims while minimizing assistance to the traffickers. I think that is the issue at the heart of the debate – which seems to get a bit lost in the original article.

    4. Fat Steve
      Fat Steve February 5, 2013 at 3:25 pm |

      I find this quote interesting– if we are fighting to protect the rights of sex workers how in heavens are we going to do this without legalization of sex work? And if we legalize sex work, how is that going to prevent sex trafficking of anyone–minor or no?

      Well, if the sex industry was legalized and regulated, then it would be a less attractive prospect for traffickers. It is much more difficult to get illegal and/or coerced workers into a government regulated business. Federal agencies are 4 times more likely to lead labor trafficking investigations than sex trafficking investigations for this very reason.

      http://bjs.ojp.usdoj.gov/index.cfm?ty=tp&tid=40

      1. Athenia
        Athenia February 6, 2013 at 10:06 am |

        Like, I’m not sure how we can treat certain sex work as a business when that will only help people who have choices. That also doesn’t help people whose bosses are running a business who are jerkwads. It doesn’t help sex workers whose business and income will be affected by government regulations.

        Not that I’m saying we shouldn’t do anything–I guess I’m just still trying to work out my view on this.

        http://thewip.net/contributors/2012/07/the_pitfalls_of_legalizing_pro.html

    5. Henry
      Henry February 5, 2013 at 4:21 pm |

      The same way we ended agricultural and manufacturing slavery. We regulate strip tease clubs now – and that is a form of sex work. when you have to report income and subject yourself to OSHA inspections it becomes a lot harder to run a slave camp. is there still manufacturing slavery in the USA? – yes there is, in the early 2000s the police busted a garment slave camp where the workers were kept locked up in gated apartments in LA, but this is not the norm for US manufacturing anymore.

      1. Athenia
        Athenia February 8, 2013 at 3:17 pm |

        Are you sure we’ve really ended that though? Illegal immigration puts undocumented workers in vulnerable work environments both on farms and in factories.

    6. Tyris
      Tyris February 5, 2013 at 5:56 pm |

      Do you see much whiskey smuggling going on now that the drinking of alcohol is no longer prohibited?

    7. macavitykitsune
      macavitykitsune February 5, 2013 at 6:02 pm |

      I know exactly what you mean! When they legalise sex, can rape be far behind??????? OUTLAW SEX IMMEDIATELY. Also outlaw death of old age; I hear it leads to murder.

  6. Drahill
    Drahill February 5, 2013 at 2:40 pm |

    I think the argument loses something because it seems to use the terms “sex work” and “sex trafficking” interchangably at points. I’ve always used the term “sex work” as a broad umbrella that includes all people who are in the erotic trades (I guess you could call them that). That includes all people, whether they are there voluntarily or involuntarily or regardless of circumstances. “Sex trafficking” is a crime that happens within the sex work sphere, but it’s something in particular – forcing or coercing individuals into sex work when they don’t want to. I’ve personally met individuals who do great work against sex trafficking who are perfectly fine with consensual sex work – its the non-consent aspect of trafficking that they fight against. I do believe a distinction can be made between the two, and I wish the piece was more clear with its use of terms and what it thinks.

    1. roro80
      roro80 February 5, 2013 at 6:50 pm |

      The terms are used interchangeably for a very good reason. The article is pretty clear that putting a gause of “working against sex trafficking” over what comes down to punishing sex workers has the effect of legitimizing said punishment as somehow pro-woman and universally good. The article is all about how it is those campaigning against trafficking — those part of the anti-”sex trafficking” set as opposed to just the “prostitutes are bad and sex is dirty” set — who are fundamentally harming those who do sex work. It’s not an accident or a misuse of terms. It’s the whole point.

      1. Drahill
        Drahill February 6, 2013 at 8:58 am |

        But your answer doesn’t really answer my question, or get to the point. My point wasn’t that some people in the anti-trafficking cause aren’t anti-sex work overall – of course there are. However, that does not negate the fact that anti-trafficking activism, in itself, is a noble cause because trafficking is a serious moral and legal wrong that should be stamped out. The article loses merit, to me, because it fails to distinguish that anti-trafficking activism and anti-sex work activism are inheretly two different things, even if the sentiments of activists overlap. You missed my point entirely, I think.

        1. konkonsn
          konkonsn February 6, 2013 at 10:51 am |

          The article loses merit, to me, because it fails to distinguish that anti-trafficking activism and anti-sex work activism are inheretly two different things, even if the sentiments of activists overlap.

          The article is showing that anti-sex work feminists are using the rhetoric of legitimate anti-trafficking arguments to promote their agenda. It’s not saying that anti-trafficking isn’t a good cause or that it shouldn’t be supported; it’s saying, “Hey, pay the fuck attention to why people are trying to pass laws and how they intend for those laws to be used.”

        2. Drahill
          Drahill February 6, 2013 at 11:57 am |

          The article is showing that anti-sex work feminists are using the rhetoric of legitimate anti-trafficking arguments to promote their agenda.

          But that’s not what the OP here is saying. Read above, and I quote: “Anti-sex trafficking “feminism” is anti-woman.” There is it. It’s not saying “some radical feminists use the sex-trafficking cause to persecute sex workers,” it’s saying the cause of trying to prevent sex trafficking is anti-woman. And such broad generalizations, without taking care to note that sex-trafficking activism is a cause unto itself, creates a piece that undercuts its own good points by being so general and bombastic. This isn’t a piece about how radical feminism is trying to highjack a noble cause, it’s too overreaching to do so. You’re giving the piece more credit than it deserves – its good points lost in its sensationalism.

        3. matlun
          matlun February 6, 2013 at 12:03 pm |

          However, that does not negate the fact that anti-trafficking activism, in itself, is a noble cause

          It can be, but…

          1. This is often not the actual cause, but only dishonest rhetoric. (See the OP)

          2. Even if that is the honest cause they are working for, it does not mean that their proposed “solutions” are necessarily good. The ends do not justify the means, and intent is not magic.

          Whether it is “noble cause” in theory is less important than whether the actual action they are pushing for is good.

        4. Drahill
          Drahill February 6, 2013 at 12:32 pm |

          Matlun, you’re not saying anything that hasn’t already been noted. There is plenty of debate about how to best end trafficking – but I would note that the overwhelming majority of feminists who are very active against trafficking support legalization as the single best way to remove traffickers and return autonomy to sex workers. Those who still support criminalization are generally of a mindset that considers all male-female interactions inherently unequal or unjust (so they tend to be more radical).

          Again, the OP isn’t trying to argue that anti-trafficking efforts need to be re-examined, or that they aren’t having the intending effects. It’s arguing that anti-trafficking efforts are inherently anti-woman, which isn’t true. If anything, the sentiment that drives anti-trafficking work (and note, I’m distinguishing this from anti-sex work efforts because, as I pointed out above, they are different) is inherently pro-woman. Your argument isn’t really addressing that distinction.

        5. roro80
          roro80 February 6, 2013 at 3:23 pm |

          No, you missed my point entirely. Whether it is part of their agenda or not, those who work against trafficking are fundamentally harming sex-workers, regardless of why those workers do sex work. If the victims you say you are trying to help are harmed by the work you do, you are doing it wrong. In this case, in addition to harming trafficked sex workers, those purporting to do anti-trafficking work are also harming a lot of non-trafficked sex workers.

        6. roro80
          roro80 February 6, 2013 at 3:37 pm |

          Furthermore, this very thread shows something really telling about those anti-trafficking feminists: they are refusing to listen to sex workers when they say that they are being harmed. Over and over here, and every time this subject comes up, they dismiss the lived experiences and stated needs of those affected by their “help”, and they ignore the fact that they are most certainly NOT helping trafficking victims. Whether those who do this have good intentions while being too proud and convinced of their own inherent goodness or whether they are actively seeking out to harm those they are purporting to help is actually not relevant in terms of what their victims experience at their hands. If an anti-trafficking feminist is too steeped in her own privilege to actually listen to actual sex workers talk about their lives and what they need to be safe, if those feminists refuse to acknowledge the fundamental harm they are doing to sex workers, frankly those feminists should be nowhere near any activism having to do with sex work. Let them go fight against the corporate wage gap or something.

  7. Claire
    Claire February 5, 2013 at 3:30 pm |

    I agree with everyone’s comments, particularly the last distinction between “sex work” (which can include voluntary sex acts like pornography or prostitution) vs. “sex trafficking” which generally involves very young girls who are stolen from their families, or sold by their families, into sex brothels. This is a VERY important distinction. I would like to add…

    This article seems to be implying that all women/girls involved in the sex trade have CHOSEN this lifestyle. Do you, seriously believe that a girl, given any reasonable alternative to support herself and her family, would choose that? If you do, you are incredibly naive. All girls/women in those circumstances are forced into it — poor, with little education, no resources or alternatives. The ones who “choose” it cognitively see no other option. So, while we DO need to focus on arresting the sellers (and “clients”) of women — brothel owners, traffickers, etc., we also need to focus on eliminating poverty, increasing women’s access to viable resources so they can escape their abusive, impoverished lives, and creating a worldwide environment that values women as PEOPLE, not sex toys.

    There is a LOT of work to be done. It is not all about “them over there.” We are culprits of marginalizing women in this culture too. So, change starts with raising the next generation to view girls as human beings, not objects to lust after. This means changing our western culture of sexualizing young girls. We must empower girls by creating an environment in which they are not just seen as a pretty face, but seen as strong, intelligent, capable beings who will positively impact the world. Girls need to be told they can be athletes, doctors, scientists, politicians, business owners — and then trained to accomplish these goals. Boys need to be told that girls can accomplish these things, that they are equal to them in EVERY way; that they are to be respected. We must teach our children well, if we have any hope of a better future.

    1. Li
      Li February 5, 2013 at 5:17 pm |

      All girls/women in those circumstances are forced into it — poor, with little education, no resources or alternatives.

      My first piece of advice to anyone starting a university course in the humanities is to be aware that every time you conjecture about a group of people there is probably someone in the room who actually is a member of that group.

      There is at least one sex worker commenting on this thread already. Do you seriously think that you can say this kind of shit without people noticing how mendacious it is? Or do you actually sincerely believe you know better the lives of the people you are talking over?

      1. jemima101
        jemima101 February 5, 2013 at 5:25 pm |

        Ahhh but I am not representative, I mean how can I be, I don’t want to be saved?
        My honours degree in philosophy, teaching qualification and desire not to slave in an office all day are mere hallucinations, I am actually a 19 yr old crackwhore with 4 children and no education.

        I am pleased to be called a girl though, at 40 that’s actually nice rather than incredibly patronizing.

      2. macavitykitsune
        macavitykitsune February 5, 2013 at 5:29 pm |

        My first piece of advice to anyone starting a university course in the humanities is to be aware that every time you conjecture about a group of people there is probably someone in the room who actually is a member of that group.

        Someone should tell my professor. You know, the one who decided that it was a-okay to allow a spontaneous student discussion of whether or not “that’s gay” or “you’re a queer” was acceptable or not, and acted like there wasn’t anyone in the room who’d be affected. I just pretty much hate everyone in all my classes this term, as fun as the classes themselves are.

        1. Li
          Li February 5, 2013 at 5:37 pm |

          Just between you and me, I actually did used to say this to my tutors. Except I’d hide it by framing it as a conspiratorial anecdote about silly things undergraduates do and how they obviously knew about how obnoxious it was already.

        2. jemima101
          jemima101 February 5, 2013 at 5:44 pm |

          Urgh :( Thats just horrible and poor teaching

        3. amblingalong
          amblingalong February 5, 2013 at 7:45 pm |

          Someone should tell my professor. You know, the one who decided that it was a-okay to allow a spontaneous student discussion of whether or not “that’s gay” or “you’re a queer” was acceptable or not, and acted like there wasn’t anyone in the room who’d be affected. I just pretty much hate everyone in all my classes this term, as fun as the classes themselves are.

          So I’m straight and I fully realize I might be about to make a huge ass of myself, but… I’m missing the point. Is this about tone, not content? I’ve actually really been grateful for times when professors have engendered discussions about using phrases like ‘that’s so ghetto.’ It sounds like that’s a valuable conversation for the professor to allow and not shut down; maybe this is totally idiosyncratic but I think people learn better through dialogue and engagement than having the person at the front of the class tell them what to believe.

          Truly am sorry if I’m being part of the problem.

        4. EG
          EG February 5, 2013 at 8:14 pm |

          It’s the idea that one should not give legitimacy to the position that it’s acceptable to use the phrase “that’s so gay,” in the same way that I would not allow a “debate” over whether or not the Holocaust happened. By allowing that there’s a “debate” or “controversy” that should be “taught,” you grant legitimacy to both sides and equate them.

          In my classroom, racist, misogynist, homophobic language is not acceptable. I will happily explain why not, but it is not up for debate. And that is because it is less important to me to make a teachable moment for students who say “that’s so gay,” than it is for me to let students who are gay, or who have loved ones who are gay that I support them, that in my classroom their thoughts, feelings, and lives matter. And if the homophobic students wish to debate the matter, there is no reason for me to subject gay students to their hurtful insults. Those students are welcome to discuss the matter with me in office hours or over email.

          A friend of mine once led a discussion of racist language that was a “model” of what those teachable moments are supposed to be–calm, respectful, explaining why the language is harmful and how it is not just a children’s book that doesn’t matter. And the next class, not one of the students of color turned up. It was just too emotionally exhausting. I’m not putting my gay students through that in order to teach the homophobes. They shouldn’t have to sacrifice themselves.

          “That’s so gay” is no more acceptable in my classroom than “that character is a c—.” It’s not up for debate.

        5. amblingalong
          amblingalong February 5, 2013 at 11:49 pm |

          Alright, I think I misunderstood what was going on. I read the story as someone saying ‘that’s so gay’ and other students spontaneously starting a discussion of why the language was problematic; I completely agree that it’s irresponsible to present that discussion as a ‘debate’ where both sides have equal legitimacy.

          Thanks for being patient enough to explain it to me.

        6. macavitykitsune
          macavitykitsune February 5, 2013 at 11:56 pm |

          Amblingalong, sorry I missed your comment earlier: what EG describes is basically what happened. The professor made a comment about usage of “queer”, I pointed out that it was a slur unless it was a self-definition, and the conversation wandered on to “that’s so gay” with the general consensus among the others being that it “didn’t have anything to do with gay people, I’m fine with gay people, it’s just, you know, it’s not LIKE THAT.”

          EG: I wish I was in your classroom. It sounds like a nice place to be. And at least I wouldn’t have to brace for spontaneous shittiness all the time.

          Li, jemima: thanks!

        7. amblingalong
          amblingalong February 6, 2013 at 12:00 am |

          Amblingalong, sorry I missed your comment earlier: what EG describes is basically what happened. The professor made a comment about usage of “queer”, I pointed out that it was a slur unless it was a self-definition, and the conversation wandered on to “that’s so gay” with the general consensus among the others being that it “didn’t have anything to do with gay people, I’m fine with gay people, it’s just, you know, it’s not LIKE THAT.”

          That’s really shitty. I’m sorry.

          I often had the opposite experience, where someone would make a comment I found really problematic, and the professor would clamp down on the discussion before I- or any of my allies in the class- were able to really talk about why we were upset. I think the prof was attempting to prevent hurt feelings, but all it did was ossify the status quo of people saying awful things.

        8. macavitykitsune
          macavitykitsune February 6, 2013 at 12:23 am |

          I often had the opposite experience, where someone would make a comment I found really problematic, and the professor would clamp down on the discussion before I- or any of my allies in the class- were able to really talk about why we were upset.

          Urgh, this is more usually the case for me, too. This thing was an anomaly. I think the worst of it was that the professor started out nominally on “my side”, but then waffled as others came out in support of saying “that’s gay”. It was…fun times.

        9. karak
          karak February 6, 2013 at 11:59 am |

          I’ve had this discussion a few times lately with “retarded”. We also read a column for someone advocating that news and media stop using the term “schizophrenic” to describe, well, anything but schizophrenia, and the whole class was arguing about how it was impossible and censorship and not that big of a deal and I wanted to leap out of my chair and deliver slaps all round.

          >Not schizophrenic, just educated

    2. roro80
      roro80 February 5, 2013 at 7:03 pm |

      This article seems to be implying that all women/girls involved in the sex trade have CHOSEN this lifestyle.

      Nope, nope it doesn’t. It doesn’t even “seem” to.

      1. Catie
        Catie February 5, 2013 at 7:35 pm |

        I agree I would like to see some evidence for where exactly it says that. Honestly I think this article is more about understanding why feminist efforts to support sex workers tend to go so poorly, than about make a moral claim one way or another about sex work itself. In fact, the article assumes that some sex workers are being hurt, and goes to discuss how one set of feminist tactics has been very unhelpful. Claiming this is not the same as making blanket statements about what sex work is or isn’t. For someone who claims to be so interested in helping victims is is surprising how unwilling you are to carefully consider what is truly in the interest of the victim, and what that person may say will help her most.

        1. jemima101
          jemima101 February 5, 2013 at 7:39 pm |

          Thank you…the article is simply saying something feminist and non feminist sex workers live with all the time.

    3. PM
      PM February 5, 2013 at 7:25 pm |

      ” Girls need to be told they can be athletes, ”

      almost certain to sustain at least one major orthopedic injury (and occasionally brain injury) with lifelong ramifications, and typically underpaid (especially women). Christ, do you know how much physical therapy Mary Lou Retton has endured?

      “doctors, ”

      overworked, deep in debt, super-stressed

      “scientists, ”

      plodding through the drudgery of graduate school, expected to focus on one subject for years in the battle for tenure, or being made to study at the whims of the bosses in the private sector.

      “politicians, ”

      look at any coverage on feminist blogs, including this one, of how female politicians are nitpicked to death in the media and in the halls of congress

      “business owners”

      super-overworked in a lousy economy, knowing the fact that most small businesses fail or barely break even

      ” — and then trained to accomplish these goals.”

      Careers in sex work, like the careers you listed, have pros and cons that the worker has to consider. The only MAJOR difference is that the ones you’ve listed have more social prestige and acceptability.

      1. karak
        karak February 6, 2013 at 12:01 pm |

        I think the MAJOR issue with sex work is the high rates of abuse and murder sex workers have, not that they feel tired or have debt.

        1. Bagelsan
          Bagelsan February 6, 2013 at 2:52 pm |

          No, I totes did grad school and it was super hard! Practically like being repeatedly raped and abused until my eventual murder!

        2. Li
          Li February 6, 2013 at 2:56 pm |

          Yeah, I get that you think that this is a super funny joke, but I know several people who were raped by other students at their university, so, um, fuck right of with that please.

        3. Bagelsan
          Bagelsan February 7, 2013 at 11:50 pm |

          The point.

          Li’s head.

    4. LotusBecca
      LotusBecca February 6, 2013 at 3:17 am |

      Basically, I think abolishing both patriarchy and capitalism would solve most of sex workers’ problems.

      And you can’t generalize about all sex workers. They choose their job for any variety of reasons, the same as people do in every other occupation. We certainly don’t need to economically coerce sex workers into choosing a different job by arresting all of their customers. Also, they don’t need an “escape” from their abusive, impoverished lives. We as a society, rather, must eliminate all abuse and poverty everywhere, whether it affects sex workers or not.

      I do agree with you, though, that men need to take responsibility for ending their attitude of superiority and entitlement, which causes them to discriminate against women and relegate us to lower paying, more menial fields of work.

      1. Niall
        Niall February 7, 2013 at 6:24 pm |

        Ditto.

        And I’d add that ending this pointless, racist and tragic fiasco called “the war on drugs” would go a long way to, if not eliminating, then at least drastically reducing the number of sex workers. Are all sex workers drug addicts? No of course not. Are most? I don’t really know. But there’s little doubt that a lot of them are doing it just to get the money for their next fix.

  8. PD
    PD February 5, 2013 at 3:34 pm |

    Really, Reason magazine? Two authors with no qualifications or experience in the field whatsoever? Inflammatory title? I generally come down on the side of sex workers (if forced to pick a ‘side’) but this is an unconvincing article and a poor choice for publication on this site.

    1. Li
      Li February 5, 2013 at 4:07 pm |

      Reason magazine! You have gone downhill! I remember when you used not to be an entirely different website!

      1. Li
        Li February 5, 2013 at 4:08 pm |

        Oh ok I have figured out that you did not actually think that you were commenting at Reason. Carry on, consider snark retracted.

        1. Tyris
          Tyris February 5, 2013 at 5:41 pm |

          You can’t just abandon a young snark like that! The parents will never take it back into the nest! Now it is doomed to squirm helplessly on the ground until eaten by the first passing critic.

  9. Zygar
    Zygar February 5, 2013 at 3:41 pm |

    This article seems like one gigantic strawman. Plus, the ludicrous idea that feminists are actively killing sex workers. And I’d be hard pressed to find a self-described feminist who regularly calls the cops on sex workers.

    1. jemima101
      jemima101 February 5, 2013 at 4:18 pm |

      Julie Burchill, leading UK feminist…

      http://tumblinfeminist.tumblr.com/post/40550903614/when-the-sex-war-is-won-prostitutes-should-be-shot-as

      http://itsjustahobby.wordpress.com/2013/01/02/melissa-fucking-farley-thinks-gang-rape-is-funny-and-it-gets-worse/

      This link, the leading anti trafficking feminist, the one whose so called research is quoted by every anti. For those who dont do links…Farley wrote this, its apparently a joke, along with another high profile feminist

      became a prostitute because . . .
      1. I saw Pretty Baby and it reminded me of my stepfather and I thought I could get paid for it.
      2. I saw Pretty Woman and I liked the clothes.
      3. I saw a Demi Moore movie and I thought, Wow, what an easy and fun way to make a million dollars.
      4. I like getting fucked by the football team, the fraternity brothers, and law students at graduation parties. I realized that gang rape could be a transcendental experience.
      5. I figured that laying on my back and getting fucked by hundreds of men, and getting on my knees and sucking thousands of dicks, was the most profound empowerment a woman could have.
      6. My vocational counselor and I discussed a whole lot of possibilities: doctor, lawyer, women’s-studies teacher, legal secretary. I was offered a four-year scholarship at Stanford, but frankly, prostitution seemed the most rewarding job option available.
      7. I worship the goddess and she told me, “Fuck mankind.” I misunderstood her spiritual message and found myself in lifetime sexual servitude instead.
      8. I came to appreciate the depth of Hugh Hefner’s, Larry Flynt’s, and Bob Guccione’s understanding of my sexuality.
      9. My boyfriend wanted me to do it. He said that being part of a stable of whores who worked for him could help me learn how to get along with other women.
      10. My father wanted me to do it.
      11. I met a nice man on alt.sex.prostitution.
      12. Camille Paglia told me it was the feminist thing to do.
      13. I felt coerced by my landlord, the day-care center, the utility companies, the grocer, my dealer and my plastic surgeons to pay my bills every month.
      14. I didn’t want to work at Red Lobster.
      15. I wanted to be treated like a lady.
      16. I went to COYOTE’s Halloween extravaganza, the Hookers’ Ball, and found out just how glamorous prostitution could be.
      17. It’s complicated, but I thought that working in the sex industry would increase my self-esteem. It’s sort of like saying to the world, “I am the best Grade A ground beef” and being the cow.
      18. And then, ya know, even though it all sounded really good, and selling fucks and blow jobs sounded really empowering, I realized that talking about it and writing books defending it would be even more empowering.

      This is the attitude I and other sex workers who try to participate in feminism get constantly. We are responsible for rape, we don’t care about trafficking, we are the problem, we are a price worth paying.

      Listen and realise intersectionality means having to check your privilege.

      We shouldn’t even have to have this debate. If WoC said there was racism would anyone give space to those shouting them down?

      1. macavitykitsune
        macavitykitsune February 5, 2013 at 4:43 pm |

        Has Julie Burchill ever opened her mouth and accidentally produced something not shit? Between this and the transmisogyny (oh and love the shitting on rape/incest survivors here), I seriously just hate her guts.

        1. jemima101
          jemima101 February 5, 2013 at 4:46 pm |

          Yup…but then love you :)

        2. Fat Steve
          Fat Steve February 5, 2013 at 5:26 pm |

          Has Julie Burchill ever opened her mouth and accidentally produced something not shit? Between this and the transmisogyny (oh and love the shitting on rape/incest survivors here), I seriously just hate her guts.

          The Boy Looked At Johnny

      2. sabrina
        sabrina February 6, 2013 at 1:03 am |

        I’m not trying to discredit what you are saying because I agree with you 100%, but WoC point out racism in this space and get shouted down for it quite a bit.

        1. jemima101
          jemima101 February 6, 2013 at 3:51 am |

          That sucks, I will try to be more aware if that happens, I am not that massive a poster, but will make sure I at least don’t add to that.

      3. Natalia
        Natalia February 6, 2013 at 2:08 pm |

        I realized that Julie Burchill is a horrible human being… but somehow, I didn’t realize that she is that much of a horrible human being.

      4. Ismone
        Ismone February 7, 2013 at 5:19 pm |

        That is staggeringly nasty. What is wrong with people.

        1. jemima101
          jemima101 February 7, 2013 at 6:40 pm |

          Yup, and this was by the woman who did the age of entry is 14 research, oh and she is racist too…

          http://glasgowsexworker.wordpress.com/2012/12/01/so-you-want-to-cite-farley/

    2. SunlessNick
      SunlessNick February 6, 2013 at 6:18 am |

      As was mentioned in the OP, Gloria Steinem advocated for the end of health education for sex workers in India. It’s not ludicrous to predict that this would result in more of them dying.

  10. Henry
    Henry February 5, 2013 at 4:29 pm |

    How about asking the Village Voice, that bastion of alternative-ness (including tons of very liberal politics), to stop hosting thinly veiled ads for prostitutes, many of whom are likely trafficked enslaved. (we like to use the word trafficked, it makes them less human as if they are walking kilos of coke – but slavery is the right word here). Until this industry is legalized and regulated and the workers kept safe and ensured they are voluntarily engaging in it, no one has any business buying these services or advertising them.

    http://observer.com/2011/04/village-voice-media-getting-down-and-dirty-with-escort-ads/

    Ditto to all the other online papers taking paid ads for such things from Google and other providers.

    This is just another way big business skims money off the sex slavery trade

    1. Li
      Li February 5, 2013 at 5:11 pm |

      Ugh stop talking now please. Ads are an important part of how sex workers earn money and frankly, they’re also extra important for sex workers who are organising their own clients independently of brothels or who want to avoid the additional harassment risks of street-based work. Fucking over workers until you reach some threshhold of appropriate utopianness =/= helping.

      1. Henry
        Henry February 5, 2013 at 7:21 pm |

        This is not organizing:

        http://www.salon.com/2012/09/26/village_voice_sex_ads_remain/

        It is a page full of advertisements for imported sex slaves. I’m not gunning for utopia – right now this industry is on the 8th level of hell when it comes to evils like slavery and violence.

        Your argument sounds like the 2nd amendment arguments – “but you’ll hurt responsible gun owners members of the sex industry”

        1. PrettyAmiable
          PrettyAmiable February 5, 2013 at 7:36 pm |

          Oh, are gun owners marginalized members of society now?

        2. Henry
          Henry February 6, 2013 at 1:26 pm |

          no, and neither are the people abusers/criminals who operate and advertise escort services. you guys are seriously defending papers that advertise slaves for hire. If the Village Voice had ads offering the rental of agricultural workers acquired in the same way most of these women are we would not be having this discussion. If so-called liberals like Dan Savage would have paid some attention to where their columns were published for years and spoken out maybe there would be some impact, ditto to any of the other people writing for these rags.

          Until someone proves to me that this industry is not filled to the brim with imported slaves and physically and mentally abused workers, I’m going to keep calling people on their bullshit. You choose to voluntarily operate in an industry like this – you have to put up with regulations, just like any business in a high risk for abuse of workers setting.

        3. PrettyAmiable
          PrettyAmiable February 7, 2013 at 7:41 pm |

          Half of the “members of the sex industry” are oppressed. I have no clue how you could say that they’re not, then talk about how none of the folks in the sex industry are oppressed. This is stupid.

          Also, please feel free to visit Lori Adorable (or not) – a feminist who works in the sex industry.

          Just because you choose to ignore voices doesn’t mean they’re not there. You’re just shutting them out.

    2. dc
      dc February 5, 2013 at 8:12 pm |

      Until this industry is legalized and regulated and the workers kept safe and ensured they are voluntarily engaging in it

      [that seems like the strongest argument Ive heard.
      if you want to protect victims you need to figure out who they actually are.only decriminalization can help the actually trafficked in many ways.i admit im convinced....if you really want to help trafficked individuals, philosophy needs to go on the back burner.]

    3. lynx wings
      lynx wings February 5, 2013 at 8:44 pm |

      As Li said, ads are important because they allow workers find and screen clients independently, instead of working for an agency or on the street. No ads affects legal sex workers as well. I’m a pro-domme and I probably wouldn’t be able to be independent if I couldn’t buy advertising space.

      I really wonder what people think removing ads will even accomplish, besides annoying sex workers. Do you think that sex traffickers will let all their slaves go free because backpage got taken down?

      They’ll just advertise on other sites, such as Eros and whatever else springs up to take its place. People protest backpage, but no one bothers Eros because it’s protected by the first amendment focuses entirely on sex work ads, so it doesn’t have to worry about losing anti-sex work customers.

      It is worth noting that Eros is considerably more expensive than backpage ($50 vs $7 for dom/fetish, and I think more for escorts) and may force some low-income workers onto the streets.

      If you eliminate all advertising, you’ll have a bunch of workers on the streets and in hotel bars, all of whom will have no way to screen clients whatsoever. Serial killers will love that, I’m sure.

    4. LotusBecca
      LotusBecca February 6, 2013 at 3:32 am |

      The majority of debt bondage that happens worldwide involves enslaved agricultural laborers, not enslaved sexual laborers. Did you know that, Henry?

      Anyway, maybe you and the radfems could start addressing agricultural slavery at a level proportional to your focus on sexual slavery–rather than using sexual slavery as an excuse to harass sex workers: hard-working women who are already being shat upon by the government and the right-wing.

      1. Henry
        Henry February 6, 2013 at 1:32 pm |

        OOOH look MOAR slaves over there! Don’t look while they herd all these 16 year old women they bought in Cambodia into the back room of the massage parlor.

        You can have your ads when you clean your shit up.

        1. Bagelsan
          Bagelsan February 6, 2013 at 2:57 pm |

          Henry, aren’t you familiar with the totally legitimate argument that other-problems-are-worse-so-shut-up? It’s widely accepted among feminists as a reason to stop talking about certain kinds of oppression! :p

        2. LotusBecca
          LotusBecca February 6, 2013 at 3:28 pm |

          My point, Henry, is the fact that y’all don’t talk HARDLY AT ALL about the most common forms of slavery is evidence that you don’t actually care about slavery. I believe you’re just feigning concern about slavery as a pretext to oppress sex workers who are not slaves. Perhaps you aren’t doing this consciously, but I hypothesize this is y’all’s underlying motivation from observing your behavior.

        3. Henry
          Henry February 6, 2013 at 7:51 pm |

          Lotus I am not feigning concern in order to oppress people. Try and stop being a troll for five seconds and listen & read the comments. I support legalization and regulation of this industry as noted in my comments on this thread. It is you who is feigning concern for the rights of sex workers so that you can keep the sex slave industry running. I work in a heavily regulated industry, they tell us what where and how we can advertise, how we can contract with clients etc. – why? because my industry is full of people who engage in criminal behavior. I have to live with this to make a living and I own up to it, not shut my eyes and pretend everything is Ok. It is not ok when plane fulls of captive slaves enter this country to service us and it is not ok to allow slavers to post ads for their services.

        4. LotusBecca
          LotusBecca February 6, 2013 at 8:09 pm |

          My apologies. I wasn’t aware you supported legalization, Henry. I admit I don’t read every comment of every thread before I jump right in (I know this is in violation of the Feministe code of conduct, but hey, I’m being honest). I still think that sex workers should be able to advertise in newspapers, however, and the fact that some slavers might also be advertising isn’t reason enough to fuck over sex workers by over-regulating them in this particular way. I think there’s a lot of better ways to tackle the injustice of slavery, honestly.

        5. jemima101
          jemima101 February 6, 2013 at 8:18 pm |

          I realize the situation in the States is different, but legalization and the attendant problems of state intrusion into peoples sex lives is itself problematic.

          Decriminlisation, which is the current UK position imo works better.

        6. LotusBecca
          LotusBecca February 6, 2013 at 8:32 pm |

          Thanks for that observation jemima; I hadn’t thought of that. I don’t have any particular horse in the game regarding decriminalization vs. legalization. I just stand in solidarity with whatever sex worker activists in any particular jurisdiction are fighting for.

        7. lynx wings
          lynx wings February 6, 2013 at 10:29 pm |

          So I can’t earn a living because bad things happen that are beyond my control. If I fix all sex trafficking do I get to have my job back? This is a serious question. I have bills to pay.

        8. Li
          Li February 6, 2013 at 11:02 pm |

          Lynx, I think you do as long as you aren’t Asian. Because Henry has seen Asian women’s pictures in ads and they are Obviously Axiomatically Slaves.

    5. Donna L
      Donna L February 6, 2013 at 12:23 pm |

      http://observer.com/2011/04/village-voice-media-getting-down-and-dirty-with-escort-ads/

      Henry, when I start reading an article and in the third line it refers to a trans woman as “a man with breast implants,” I generally stop reading. The Village Voice always used to have more ads for trans women “escorts” than for cis women. Do you believe that the trans women are all “imported sex slaves” too? Because I can promise you that they’re not; in the support groups I used to go to, I met quite a few trans women who were sex workers . They had different reasons for doing the work they did — including saving money for surgery and other transition costs — but not one of them was either “imported” or a “sex slave.”

      1. Henry
        Henry February 6, 2013 at 1:39 pm |

        If the Voice had limited it’s ads to independents I would not be screaming like I am. All I saw when I used to open that rag was a classifieds filled with ads for “Asian Massage” and pics of very young looking women. It’s why I stopped reading alt papers like it altogether.

        I linked the Observer solely for the photo of the ad page, as I could not find a PDF of the Voice easily. You can stop reading mainstream press altogether, they don’t get trans issues ever.

        I hold these papers in the same regard I hold pimps, madames, people who sell children, and other dirt. They are profitting off a business that depends heavily on slaves and needs to be decrimilinalized so existing labor laws and reporting can be enforced.

  11. macavitykitsune
    macavitykitsune February 5, 2013 at 4:42 pm |

    Well, naturally we should shame, criminalise and punish sex workers! I mean, if we stopped being misogynistic assholes to even one subset of women, we’d have to see them as human beings or something. Which just EW amirite?

    Also, I am THIS close to losing my shit entirely re: the people who wrap everything up in a nice pretty bow of “women have no agency evar and cannot possibly make choices or decide on things” (and sorry, but you know what, I’ve seen my share of such shit). I’ve yet to see one of those you can’t scratch the surface of and find a seething boil of internalised misogyny, transphobia and usually a heaping quantity of classism/racism.

  12. the_leanover
    the_leanover February 5, 2013 at 4:48 pm |

    It always staggers me (and I say it every time) how every side on this issue manages to set up such absurdly gigantic strawmen. Please, please, please can you give me a cite for one single self-identifying leftist feminist who has ever advocated arresting more sex workers as a pro-feminist strategy? Every single anti-prostitution feminist I’ve ever spoken to has advocated – with different levels of emphasis – legislating more heavily against pimps and clients, setting up support networks for exiting prostitution, and simultaneously working on poverty and unemployment. Don’t get me wrong: I’ve encountered my fair share of ridiculous, reactionary abolitionist arguments too, and some of them certainly do come with a high dose of judgment and saviour-syndrome; but the idea that their primary argument is about ‘some kinds of sex being morally worse than others’, rather than about fundamental power imbalances and economic inequity, is a fantasy. I’m not saying you have to agree with that argument as it has been applied to sex work (I’m not sure if I do, either); there are plenty of seeds of good points in here, particularly about the criminal justice system and the question of whether appealing to the state and the legal system can truly be an effective feminist strategy in this instance (and even more particularly the stats on police abuse rates that have been posted in this thread), but fixating on the notion of some prudish cabal of anti-feminist feminists who just love throwing prostitutes in jail makes it so goddamn hard to take seriously.

    1. the_leanover
      the_leanover February 5, 2013 at 5:00 pm |

      In fact, I’m gonna add a caveat: there undoubtedly are some self-described ‘feminists’ who have made those arguments (and it doesn’t surprise me in the least that Julie Burchill should be one to spout just flat-out hatred in place of points). On the other hand, I’ve read sex worker ‘feminists’ arguing (among other things) that there might be a ‘prostitution gene’ and that men just naturally have more sexual needs than women, so denying men access to sex is denying them a human right. I wouldn’t cite those as representative of sex worker rights arguments, though, because all movements have a few strands of stupidity and I’d rather engage with more substantive arguments.

      1. macavitykitsune
        macavitykitsune February 5, 2013 at 5:11 pm |

        So, you can’t find one self-identified feminist saying these things, except for the self-identified feminists who you’ve seen say these things, but they totes don’t count because….

        …pandas? Leprechauns? Convenience?

        I wonder what it could be!

        1. jemima101
          jemima101 February 5, 2013 at 5:15 pm |

          And there is an issue of voice. I can’t think of one sex worker feminist (and they are rare as hens teeth, so I pretty much read everything they write) who has columns in the national press or is invited to speak at international conferences.

        2. the_leanover
          the_leanover February 5, 2013 at 5:29 pm |

          Sure, they count, to the extent that stupid pro-sex-work arguments ‘count’. I’d just prefer they weren’t portrayed as the main arguments of left-wing pro-abolition feminists (as opposed to the arguments of conservatives who undoubtedly exploit a veneer of ‘feminism’ while *actually* wanting to throw sex workers in jail, but those are irrelevant in the sense that Sarah Palin’s ‘feminists for life’ are irrelevant).

          I probably sound like I’m coming from an abolitionist perspective here, but I’ll reiterate that I hop right on over to the other side when I get to read (as often pops up in my city’s local feminist network facebook group) about how all sex worker rights advocates are neoliberal sellouts, shills of the sex industry, and that all prostitution and porn is axiomatically rape. Now, some sex worker rights advocates probably do have extremely dodgy neoliberal colonialist politics that are at odds with women’s liberation, just like some abolitionists have condescending anti-sex conservative statist politics that are at odds with women’s liberation. But I’d find it unproductive to paint the entire argument in those terms.

        3. Li
          Li February 5, 2013 at 5:29 pm |

          No feminists are anti sex worker! Therefore any feminists who are anti sex worker aren’t really feminists! Therefore no feminists are anti sex worker!

          Sex workers are coerced into the work and have a negative experience! Therefore sex workers who like their jobs and have a positive experience are unrepresentative! Therefore sex workers are coerced into the work and have a negative experience!

        4. the_leanover
          the_leanover February 5, 2013 at 5:36 pm |

          To jemima’s point about voice: that’s an interesting one, because I suspect the situation in that respect is slightly different in the US/Canada than it is here in the UK. Certainly anti-prostitution voices here are loud, and they probably were dominant until relatively recently, but in the past few years I’ve noticed quite a shift in the editorial perspective of (to take one example) the Guardian, which has started to run fairly regular pieces from sex worker’s perspectives. My perspective on the US is different too, because I follow feminist blogs more than I follow the mainstream press, almost all of which take a distinctly pro-sex work slant, which probably gives me a disproportionate view of the discourse.

        5. jemima101
          jemima101 February 5, 2013 at 5:53 pm |

          Given that Scotland and Northern Ireland are both trying to introduce the Nordic model, and there are moves from Object, Banyard, Normas and almost every other group you can mention to bring it in in England, I don’t think Guardian readers are leading this debate.

        6. Li
          Li February 5, 2013 at 5:49 pm |

          the_leanover

          The arguments of people like Julie Birchill and Sheila Jeffreys aren’t just being “portrayed” as being the main arguments of left-wing pro-abolitionist feminists, they’re legitimately their arguments and Julie Birchill get massive fucking space in which to air them. It’s not just “some” abolitionists with anti-sex condescending statist politics, it’s major fucking voices in the abolitionist movement. That is, if abolitionists are pissed about their portrayal, they should probably take it up with those women who spend very very large portions of their career going after sex workers (and, not-coincidentally, trans women) in national and international media.

        7. the_leanover
          the_leanover February 5, 2013 at 6:12 pm |

          Li: no disagreement here that those people should be called out, and I have absolutely no time for either of those women. But this article – and a lot of other articles like it – is not talking about a few awful voices that should be shut out of the discourse; it’s talking about ‘anti-sex-trafficking feminism’ as a discourse, which feels to me very much like saying ‘feminism as a discourse is inherently anti-trans, because people like Julie Burchill and Sheila Jeffreys have public platforms as feminists’. An entire political analysis shouldn’t be reduced to its most hateful voices any more than those voices should be tolerated. And painting ‘anti-sex-trafficking feminism’ as an inherently prudish, conservative movement that hates sex workers cos they’re so icky and slutty feels very much like the abolitionist articles that paint all ‘pro-porn feminism’ as ‘fun feminism’ that’s all about neoliberal Choosing My Choice and sexy-empowerment that hates trafficked women because they ruin its image. Some ‘pro-porn feminism’ is like that, and plenty of it does get national platforms (in my country, anyway), but to set up an abolitionist argument solely against that is eliding all the very real and important critiques about consent and autonomy and sex workers’ safety.

          (I’m not normally a fence-sitter, and I don’t normally bother getting into these debates because it’s weird and frustrating to get into the fence-sitter’s endless trail of caveats and analogies, so I think I’ll stop there…)

        8. the_leanover
          the_leanover February 5, 2013 at 6:30 pm |

          jemima: my point was that it is very much a debate, rather than the monolithic anti-prostitution mainstream consensus that you seemed to be describing by saying you couldn’t think of ‘one single sex worker feminist’ writing in the national press. I was just pointing out that here, there are several; they may not be ‘leading the debate’, but they are represented.

          I know all about the well-documented problems with the Nordic Model, but this is precisely the point – the vast majority of abolitionists here (all, that I know of) favour the Nordic Model, which is specifically about not putting sex workers in prison. So argue with the actual problems with that model, rather than stating that feminist ‘energy … is being spent putting women into jail’. I mean, yes, energy is being spent putting women into jail, and that’s fucking appalling, but it’s not feminists that are doing it.

        9. Ismone
          Ismone February 5, 2013 at 10:18 pm |

          But the article doesn’t name them. See my post below about all the stuff Steinem actually said. She is the only real “feminist” they name.

          I don’t think that even the feminists who use the “prostituted persons” label (which I recognize is problematic, mainly imo because it erases agency, but frankly, I think applying the label of sex worker is also problematic because it assumes agency, at least depending on how you feel about work) really want anyone (other than maybe Johns) in prison.

          I don’t buy that feminists are the bad ones here–maybe law enforcement, the legal system, transphobia, and some assy feminists, but not feminists writ large or en masse.

        10. Random Observer
          Random Observer February 6, 2013 at 4:34 am |

          Leanover – it sounds like you’re making a bit of a “No True Scotsman” argument here. Sure, abolitionist feminists may not believe in arresting sex workers off in some Platonic ideal, but I think you need to get your head out idealism and take a close look at what “abolitionism”, including feminist abolitionism, amounts to in practice.

          And I’ll say, unreservedly, that in a US context anyway, advocacy of the Nordic model is always a smokescreen for putting more sex workers in jail. I suggest you read up specifically on how prostitution was re-criminalized in Rhode Island and how a ‘feminist’ Donna M. Hughes and her allies, who talk a good game about the Swedish model too, specifically blocked a version of the new law that involved lesser punishments for those selling sex in favor of one with harsher punishments for those selling sexual services. And I don’t see Donna Hughes exactly being censured by any segment of the “abolitionist” movement, feminist or otherwise, for that.

          And were you aware of this article from a few months back pointing out who abolitionist-feminist-sounding “End Demand” policies in practice amount to jailing more sex workers?:

          http://www.chicagoreporter.com/news/2012/11/escorted-jail

          One would think this would give those feminists in question pause and make them rethink their approach. If so, I’ve seen no sign of it.

          So, yes, just looking at real-world effects rather than supposedly lofty ideals, “abolitionist” feminism comes out looking pretty whore-hating.

      2. tomek
        tomek February 5, 2013 at 5:18 pm |

        On the other hand, I’ve read sex worker ‘feminists’ arguing (among other things) that there might be a ‘prostitution gene’ and that men just naturally have more sexual needs than women

        and you dismis this for what? have you examined scientific evidence of these things? I think not

        1. macavitykitsune
          macavitykitsune February 5, 2013 at 5:47 pm |

          Tomek,

          I think the existence of an “I need to have sex for money” gene is exactly as ridiculous as an “I need to flip burgers/tally receipts/do lifeguarding for money” gene.

          You don’t need to eat the whole egg to know if it’s rotten.

        2. Donna L
          Donna L February 5, 2013 at 5:56 pm |

          When did Tomek get back?

        3. tomek
          tomek February 5, 2013 at 6:06 pm |

          no i am mean that men have naturally more sex needs than woman.

          if demand was not there for sex work, it would not exist, that is econimics of situation. there are very few men do sex work (and tiny number who do sex work for woman).. because woman have less need for sex.

          and obvious there is no “sex work gene” but clearly some woman feel good about doing sex work but themself, and other woman feel they would never do it. thats probably in the genetic, though it is more complicated than simple yes/no sex work gene.

          i think discussion would be of benefit if everyone realise not everyone else like them. anti-sex-work femenist should realise that not all woman feel bad about sex work and some do because they want. sex worker advocate should realise that not all woman want to be sex worker, and that some are forced in bad position like in traficking. both sides should merge viewpoint and obtain good solution for all.

        4. Tyris
          Tyris February 5, 2013 at 6:09 pm |

          Of course the prostitution gene exists! It looks a little something like AGCCCTCCAGGACAGGCTGCATCAGAAGAGGCCATCAAGCAGGTCTGTTCCAAGGGCCTTTGCGTCAGGTGGGCTCAGGATTCCAGGGTGGCTGGACCCCAGGCCCCAGCTCTGCAGCAGGGAGGACGTGGCTGGGCTCGTGAAGCATGTGGGGGTGAGCCCAGGGGCCCCAAGGCAGGGCACCTGGCCTTCAGCCTGCCTCAGCCCTGCCTGTCTCCCAGATCACTGTCCTTCTGCCATGGCCCTGTGGATGCGCCTCCTGCCCCTGCTGGCGCTGCTGGCCCTCTGGGGACCTGACCCAGCCGCAGCCTTTGTGAACCAACACCTGTGCGGCTCACACCTGGTGGAAGCTCTCTACCTAGTGTGCGGGGAACGAGGCTTCTTCTACACACCCAAGACCCGCCGGGAGGCAGAGGACCTGCAGGGTGAGCCAACTGCCCATTGCTGCCCCTGGCCGCCCCCAGCCACCCCCTGCTCCTGGCGCTCCCACCCAGCATGGGCAGAAGGGGGCAGGAGGCTGCCACCCAGCAGGGGGTCAGGTGCACTTTTTTAAAAAGAAGTTCTCTTGGTCACGTCCTAAAAGTGACCAGCTCCCTGTGGCCCAGTCAGAATCTCAGCCTGAGGACGGTGTTGGCTTCGGCAGCCCCGAGATACATCAGAGGGTGGGCACGCTCCTCCCTCCACTCGCCCCTCAAACAAATGCCCCGCAGCCCATTTCTCCACCCTCATTTGATGACCGCAGATTCAAGTGTTTTGTTAAGTAAAGTCCTGGGTGACCTGGGGTCACAGGGTGCCCCACGCTGCCTGCCTCTGGGCGAACACCCCATCACGCCCGGAGGAGGGCGTGGCTGCCTGCCTGAGTGGGCCAGACCCCTGTCGCCAGGCCTCACGGCAGCTCCATAGTCAGGAGATGGGGAAGATGCTGGGGACAGGCCCTGGGGAGAAGTACTGGGATCACCTGTTCAGGCTCCCACTGTGACGCTGCCCCGGGGCGGGGGAAGGAGGTGGGACATGTGGGCGTTGGGGCCTGTAGGTCCACACCCAGTGTGGGTGACCCTCCCTCTAACCTGGGTCCAGCCCGGCTGGAGATGGGTGGGAGTGCGACCTAGGGCTGGCGGGCAGGCGGGCACTGTGTCTCCCTGACTGTGTCCTCCTGTGTCCCTCTGCCTCGCCGCTGTTCCGGAACCTGCTCTGCGCGGCACGTCCTGGCAGTGGGGCAGGTGGAGCTGGGCGGGGGCCCTGGTGCAGGCAGCCTGCAGCCCTTGGCCCTGGAGGGGTCCCTGCAGAAGCGTGGCATTGTGGAACAATGCTGTACCAGCATCTGCTCCCTCTACCAGCTGGAGAACTACTGCAACTAGACGCAGCCCGCAGGCAGCCCCACACCCGCCGCCTCCTGCACCGAGAGAGATGGAATAAAGCCCTTGAACCAGC

          Or possibly that might be insulin. Tricky things, DNA sequences.

          Seriously though, proving an absence is one of those big logical no-nos. So if you’d like us to believe that there is such a gene, by all means go and find it! Take a year! Take ten! And don’t forget to pick up some basic idea of genetics while you’re at it.

        5. the_leanover
          the_leanover February 5, 2013 at 6:20 pm |

          oh shoosh, tomek

        6. Kasabian
          Kasabian February 5, 2013 at 6:29 pm |

          I don’t know why I’m bothering to defend this, but technically Tomek’s quoting a reference to a “men need more sex” gene rather than a “women need money for sex” gene.

          Because. You know. Important to get your baffling pseudoscience right.

          Saaaaaaaaadface.

        7. macavitykitsune
          macavitykitsune February 5, 2013 at 6:31 pm |

          technically Tomek’s quoting a reference to a “men need more sex” gene rather than a “women need money for sex” gene.

          Tomek did say “these things”, though, not “this thing”. He doesn’t have pluralisation issues, so it looks like he’s trying to defend ALL the badscience at once. Impressive, but doomed. (doomEDD, even.)

        8. jemima101
          jemima101 February 5, 2013 at 6:52 pm |

          Sort of off topic, but even if there was such a gene, (and the studies into sexual selection by people like Helena Cronin suggest women would have it not men) What does that actually have to do with sex work?

          One of the biggest claims of anti sex work feminists is that men visiting sex workers do not have a right to sex. Oddly sex workers agree, only in sex work * is a sexual transaction so time and content limited. Rarely in other sexual relationships is the list of dos and donts so explicitly listed before hand, or in the hands of the woman. **

          If men did have a greater genetic propensity for sex it wouldn’t make the slightest difference to this argument. Sex workers are not obliged to say yes, nor does anyone have the right to visit one. This is so much a part of our lives that we should be the greatest allies going in fighting trafficking and rape culture

          * i waver on using the term consensual sex work, cos like “child porn” and “child prostitution” I think it suggests something more sanitized than the reality, sex work is sex work , rape is rape.

          ** I am limiting to female sex workers cos that’s what people are talking about, of course male and trans* sex wokers exist, and are even more neglected.

        9. the_leanover
          the_leanover February 5, 2013 at 6:33 pm |

          No, actually 4realz, I read someone arguing for a ‘some women are just naturally prostitutes, it’s like an ingrained sexuality’ gene. And let’s not forget that ‘women are all technically prostitutes that need something in exchange for sex’ is hardly a niche idea, either…

        10. Kasabian
          Kasabian February 5, 2013 at 6:44 pm |

          Tomek did say “these things”, though, not “this thing”. He doesn’t have pluralisation issues, so it looks like he’s trying to defend ALL the badscience at once. Impressive, but doomed. (doomEDD, even.)

          He has a point though, we HAVEN’T done thorough research on this! I’m going to check my privilege and read up on all the latest zany pseudo-science bullshit!

        11. PM
          PM February 5, 2013 at 7:37 pm |

          Jill said that she reads tomek’s posts in the “How is babby formed?” voice: http://www.youtube.com/watch?v=w_RaPOOVX1Y

          and I have to admit that I now enjoy and even look forward to his posts.

        12. Rhoanna
          Rhoanna February 6, 2013 at 9:06 am |

          ** I am limiting to female sex workers cos that’s what people are talking about, of course male and trans* sex wokers exist, and are even more neglected.

          Um, trans isn’t some third, ‘other’ category. And most trans sex workers are women.

        13. jemima101
          jemima101 February 6, 2013 at 10:00 am |

          Oh wow , apologies i totally did not mean that and thank you for pointing it out.

      1. the_leanover
        the_leanover February 5, 2013 at 5:30 pm |

        Your post appeared after I posted mine; hence the caveat.

        1. Kasabian
          Kasabian February 5, 2013 at 6:30 pm |

          hence the handwave.

          Fixed that for you.

    2. LotusBecca
      LotusBecca February 6, 2013 at 3:56 am |

      I actually agree with you in large part, the_leanover. I think that more allies of sex workers need to point out that not only is imprisoning sex workers bullshit, but imprisoning their customers a la the Swedish model is also bullshit. It’s not helping or standing in solidarity with workers when you’re trying to make it impossible for tem to make a living, especially when every organized political group of said workers is urging you NOT to make their lives harder by criminalizing their customers. An abolitionist I was debating with recently linked me to this article by a Swedish feminist, anarcho-socialist, and abolitionist. This woman is definitely on the left, and she definitely doesn’t think of herself as a moralist. Yet all the usual crap is there, the condescending phrase “prostituted women,” the made-up statistics courtesy of Melissa Farley, the conflation of consensual sex and rape, and a bunch of other offensive garbage. In fact, I have yet to see a abolitionist argument that hasn’t been predicated in large part on what I would consider to be offensive garbage, unfortunately, even if most of them aren’t quite as bad as Julie Birchill.

    3. Wendy Lyon
      Wendy Lyon February 6, 2013 at 4:17 am |

      Two examples of high-profile anti-prostitution feminists supporting criminalisation of sex workers, not just their clients or pimps:

      1. Melissa Farley testifying for the Crown in Bedford v Canada, supporting the retention of three criminal laws of which two are primarily used against sex workers.

      2. Donna Hughes calling it a “victory” when Rhode Island criminalised indoor prostitution – making the sale as well as the purchase of sex illegal.

      It strikes me that US-based anti-prostitution feminists, in general, spend an inordinate amount of time campaigning against the decriminalisation of buying sex (something that doesn’t seem to be on the cards virtually anywhere in the US anyway), and very little campaigning for the decriminalisation of selling it, which they claim to support.

      1. the_leanover
        the_leanover February 6, 2013 at 11:14 am |

        Btw, to everyone that replied to me above: I’d like to apologise for speaking from a place of some ignorance about the anti-prostitution discourse outside of my own rather narrow circle. On further reflection, it seems that there are more high-profile abolitionists with a decidedly sketchy agenda than I’d been aware of. My instinctive reaction came from mostly having interacted with abolitionists who I believe truly do have good intentions towards women and sex workers, even if their arguments are not always convincing (and who, perhaps not incidentally, are not primarily anti-prostitution activists but socialist activists who campaign on a whole range of anti-poverty and anti-rape-culture issues). I still sympathise, to some extent, with the ideological stance that the sex industry as it exists in its current form is not a positive thing to exist for women in general, that it’s hard to reconcile with any feminist opposition to women’s bodily commodification, and I think there’s still an abstract debate to be had about that (as part of an abstract debate about the overthrow of capitalism and wage-slavery and patriarchy in general); at the same time, I’m now pretty thoroughly onboard with the idea that in practical terms, abolitionist policies and the movement as it exists now are not positive things for sex workers, and that many of them are not coming from the good-faith place that I had previously credited them with.

        1. LotusBecca
          LotusBecca February 6, 2013 at 3:48 pm |

          Wow. This surprised me. It’s rare to see people on the internet be so self-reflective and actually modify their views somewhat. I admire your thoughtfulness, the_leanover.

          And I have no doubt that there are abolitionists who really do care about and respect sex workers, and merely oppose sex work as part of a broader philosophy of social justice that they have. I don’t think they have a significant impact on the broader abolitionist movement, however, which I see as inherently anti-sex-worker. I’m glad it seems you’ve come around to this position as well.

          Also, I’m not sure if you’ll find any anti-capitalist, non-abolitionist feminist who thinks the sex industry is good for women, since by default we kinda think all industries, as currently constituted, are bad for women (and men). I think where we differ from abolitionists is that we don’t think it’s possibly to eliminate the sex industry while still maintaining a capitalist economy, and abolitionists do seem to think this is possible, at least if we look at their actions (their willingness to cooperate with the capitalist state, for example).

        2. jemima101
          jemima101 February 6, 2013 at 5:13 pm |

          What an incredibly brave and honest thing to post :)

  13. Claire
    Claire February 5, 2013 at 5:21 pm |

    Educate yourself on sex trafficking:

    This is not a choice.
    Feminists are not supporting this.
    Poorly constructed argument to say the least.

    Whether you believe prostitution should be legal or not, it is clear that it is vastly different than sex trafficking.

  14. Thalia
    Thalia February 5, 2013 at 5:26 pm |

    sigh

    I have to admit, I wrote a lot of paper on sex trafficking and the global sex trafficking when I was doing my undergraduate. I really thought I was sooooo smart. Then I got older and realized how much of an idiot I was and now…

    sigh

    1. macavitykitsune
      macavitykitsune February 5, 2013 at 5:39 pm |

      Well, and sex trafficking IS a heinous thing and something I hate and oppose. It’s just that consensual sex work is to sex trafficking as teenagers necking at prom is to the Delhi bus gang rape.

      1. Thalia
        Thalia February 5, 2013 at 5:51 pm |

        I know! I think what I lament more is that I often conflated the two. I was sitting in the ivory tower of academia and assuming I knew what was going on around me. I also wrote papers on why Canada should legalize prostitution (from an oddly capitalistic perspective, to be honest) and I’d like to think I’ve grown from there.

        I don’t care for the idea of feminism being a monolith where every feminist conforms in ideas, theories, and actions but it sucks that feminism and feminists can’t figure out how to support people without seemingly trashing another group of individuals. Or at least, the ones who are most often heard can’t seem to do that.

      2. wembley
        wembley February 6, 2013 at 10:32 am |

        Wait wait wait. This is part of what frustrates me about these conversations: so there’s sexual slavery/trafficking and there’s consensual prostitution — but what would you call someone who’s engaging in survival sex (aka not what we would call “enthusiastic consent”) because they’re a runaway but there’s no pimp involved? Or a street prostitute who’s doing this due to economic hardship? How are you categorizing it when capitalism/a shitty economy is the pimp? I don’t think it’s controversial to say that there’s a huge difference between, say, a white cis middle+ class pro-domme and the kids in this article.

  15. tigtog
    tigtog February 5, 2013 at 5:42 pm | *

    Quick moderator note: because of the topic many comments are being placed into the auto-moderation queue. This means that somebody’s answer to your comment may be held up and published belatedly. Please be aware of these technical limitations on the discussion!

  16. amblingalong
    amblingalong February 5, 2013 at 7:51 pm |

    I’m deeply confused by all the people here who seem to think it’s impossible to be pro-sex-worker and support decriminalization/legalization and also work against kidnapping people and raping them. Somebody explain this to me?

    Like, I get that there are people who do shitty anti-sex-worker anti-women things under the guise of anti-sex-trafficking, but to decide that all attempts to stop sex trafficking are evil, and to make pronouncements like “anti-sex-trafficking is anti-women” just seems fucking stupid.

    1. jemima101
      jemima101 February 5, 2013 at 8:17 pm |

      No whats really fecking stupid is to read an article about how shittly sex workers are treated by anti sex work feminists and assume it means people supporting it are somehow unable to see the evils of rape.

      1. macavitykitsune
        macavitykitsune February 5, 2013 at 8:24 pm |

        This.

        1. lane
          lane February 6, 2013 at 1:13 am |

          All the anti-sexual exploitation (not sex work that’s pimp talk) feminists I know were sexually exploited. They are speaking from experience.

          See Sex Trade 101, FB or website. See The Whistleblower. And this: http://soul-destruction.com/voices-of-prostitution-survivors/#The-Magic-Number-18\

          Voices of experience. Women who put their stories up front backed by their names and faces and rap sheets.

          You can dismiss them AFTER you’ve listened. Try… .

      2. amblingalong
        amblingalong February 5, 2013 at 11:47 pm |

        No whats really fecking stupid is to read an article about how shittly sex workers are treated by anti sex work feminists and assume it means people supporting it are somehow unable to see the evils of rape.

        No. I’m not responding to the article (which I think was largely good). I’m responding to commentary on the article.

        My only criticism of the article is that it uses a sloppy rhetorical trick of making the actions of anti-sex-trafficking feminists the necessary definition of anti-sex-trafficking feminism. It’s really silly to say “anti-sex-trafficking feminism is anti-women” because prominent anti-sex-trafficking feminists are anti-women, just like it’s silly to say “feminism is anti-black” just because many prominent feminists are really good at saying stupid shit about race.

        The Important Internet Feminists don’t get to define the entire movement, and the Important Anti-Trafficking Feminists don’t get to define anti-trafficking feminism. I enthusiastically call out anti-sex-trafficking people who start to verge into anti-sex-worker territory; I don’t need to renounce anti-trafficking feminism entirely.

        1. matlun
          matlun February 6, 2013 at 12:22 pm |

          @amblingalong: Don’t you have to be able to generalize at least somewhat to be able to have a meaningful discussion?

          The argument is not really about the semantic definition of “anti-sex-trafficking feminism” (as opposed to what? “pro-sex-trafficking feminism”?), but about what the politics of this group actually are.

          If 90% of the group is giving the other 10% a bad name, this might perhaps be seen as unfair by those individuals, but it is hardly unreasonable.

    2. Li
      Li February 6, 2013 at 12:00 am |

      Let’s put it this way: If you want to be pro sex worker and also work against trafficking you need to consider the impacts of your work on sex workers and not just view their lives as collateral. So, for instance, you need to find a way to deal with increased police profiling of migrant workers (in the context of Australia at least, specifically Asian women) and the attendant exposures to police violence and deportation. And if you don’t do that preparationto prevent your work harming women then I’m going to give your projects massive fucking side-eye.

      1. amblingalong
        amblingalong February 6, 2013 at 1:49 am |

        Let’s put it this way: If you want to be pro sex worker and also work against trafficking you need to consider the impacts of your work on sex workers and not just view their lives as collateral. So, for instance, you need to find a way to deal with increased police profiling of migrant workers (in the context of Australia at least, specifically Asian women) and the attendant exposures to police violence and deportation. And if you don’t do that preparationto prevent your work harming women then I’m going to give your projects massive fucking side-eye.

        Absolutely. What my argument boils down to is that the remedy to anti-sex-worker behavior by anti-trafficking feminists is more and better feminism, not an abandonment of anti-trafficking feminism entirely. When I’m asked to do some work on trafficking-related issues (which isn’t that often, but does happen from time to time) I find my feminism to be an incredibly useful tool as I’m grappling with everything.

        What I’m pushing for is to reclaim anti-trafficking feminism instead of discarding anti-trafficking feminism, which is what it sounds like some people want to do. Not that those people aren’t against trafficking- obviously everybody here is- but that they seem to want to get rid of the brand.

        1. Li
          Li February 6, 2013 at 2:48 am |

          I understand and respect that perspective, but I just really don’t have the energy for reclaiming anti-trafficking feminism from the haters. It’s just simpler for me personally to work with the sex workers’ rights movement (which also does anti-trafficking work, though it tends to take the form of industrial rights and peer support) rather than with the anti-trafficking movement, because I don’t have to do vast amounts of effort preparing the ground for actually intersectional work. And I’m a person that’s relatively non-personally targeted by the shit in the anti-trafficking movement. Sex workers? Trans* people? I am pretty willing to let them make the call to just say “fuck it” and organising elsewhere.

        2. jemima101
          jemima101 February 6, 2013 at 3:56 am |

          Yup :( I have a blog brewing on this, sex workers should be the anti trafficking movements greatest allies, instead we are there biggest threat, and we ourselves, I recognize, can seem dismissive of the experience of trafficked people because we are constantly fighting for our right to exist.

  17. Elle Fury
    Elle Fury February 5, 2013 at 8:53 pm |

    I just wonder why the most privileged of us humans (i.e. white middle and upper class heterosexual males) don’t ever make the “choice” to do sex work? Surely, if this is such wonderful “work” , we would see more of these indivduals out there working the streets and brothels. Yet we don’t. Can any of you empowerfullized “sex positive “feminists” explain this to me?

    1. macavitykitsune
      macavitykitsune February 5, 2013 at 11:44 pm |

      empowerfullized “sex positive “feminists”

      Yeah, seriously, fuck right off with the condescension. Or at least learn to use sarcasm quotes correctly.

    2. macavitykitsune
      macavitykitsune February 5, 2013 at 11:47 pm |

      And I would point out that there are many, many professions that are essential and/or wonderful (I do not personally know I would count sex work in either of these categories, though I actually give a shit about women, so it doesn’t affect my support of sex workers), like motherhood, teaching and nursing are also fields into which upper-class SWAGs rarely venture, but you probably think SAHMs are swooning bimbos, too, so whatever.

      1. amblingalong
        amblingalong February 5, 2013 at 11:56 pm |

        SWAGs

        Straight white… something… guys? Google failed me.

        And I would point out that there are many, many professions that are essential and/or wonderful

        Yeah, I think an essential point for me is that its not necessary to paint a super-duper rosy picture of sex work in order to defend the rights/moral agency of people who choose to do it. I know a lot of people who absolutely hate their job, but that doesn’t mean society suddenly swoops down to close their evil exploitative call center (or whatever).

        Some people probably love sex work. I would guess a much larger number simply see it as their job, which has advantages and disadvantages, and sometimes sucks, but probably sucks a lot more because of all the stupid societal shit they have to put up with. But even the people who hate being sex workers aren’t being de facto exploited any more than people who hate being burger-flippers.

        1. macavitykitsune
          macavitykitsune February 6, 2013 at 12:02 am |

          straight, white, abled guys. Sorry!

          Yeah, I think an essential point for me is that its not necessary to paint a super-duper rosy picture of sex work in order to defend the rights/moral agency of people who choose to do it.

          THIS.

          Also, I happen to think that Ur Random Sex Worker is far more moral a professional being than Ur Random Politician. I still don’t support systematically raping, abusing and murdering politicians! Maybe a daily slapping with a large dead salmon though….

        2. Li
          Li February 6, 2013 at 12:28 am |

          Maybe a daily slapping with a large dead salmon though….

          My google image search history probably features “_______ being smacked in the face with a fish” far too frequently.

      2. Elle Fury
        Elle Fury February 6, 2013 at 1:38 am |

        Not great examples.

        A lot of white hetero males are teachers… and professors.

        Yes, white hetero male nurses are rare, but white hetero male doctors, who perform similar services, are not.

        Um, mothers? What?

        The point I was trying to make is that if it were true that working in prostitution can all be boiled down to the making of an individual choice (and thus the oppression of women and non-whites has no relationship to the issue at all), then you would THINK that there’d be at least some white hetero males making this “choice” too. But are there even any?

        The fact that the most privileged members of a society are not choosing to work in a certain “profession” tells you everything you need to know about that “profession” and whether the “choice” to get into that profession is truly a choice at all.

        1. macavitykitsune
          macavitykitsune February 6, 2013 at 1:53 am |

          you would THINK that there’d be at least some white hetero males making this “choice” too. But are there even any?

          Oh, I thought you knew something about the industry before you talked. Guess not? Also I guess every male in porn is an android, then. THE REVELATION OMG.

          The fact that the most privileged members of a society are not choosing to work in a certain “profession” tells you everything you need to know about that “profession” and whether the “choice” to get into that profession is truly a choice at all.

          Okee! So tell me: how many upper-class white straight men work in the drive-through lines at Burger King? Or as assembly-line workers at Ford? How about bellhops at the Ritz? I guess those people are all exactly the same as slaves too?

          Also, breaking news: ordinary people need jobs to eat. If you’re one of the few who could never work another day and get all your needs taken care of, woohoo for you! The rest of us live in the real world where we’re pretty fucking coerced into having jobs (even when we like them) because otherwise we don’t have food or shelter.

          Christfuck it’s like you people don’t even live on the same planet.

        2. PeggyLuWho
          PeggyLuWho February 6, 2013 at 2:01 am |

          Oh, come now macavity, you know sex is magic, and unlike any other activity that human beings engage in, so it can’t be like cooking a burger. It has to be **special** and if you can do it just to pay your rent, something MUST BE WRONG WITH YOU.

          Unless you’re a dude, because everyone knows dudes have sex all the time without it being special or having anything to do with morals.

          Seriously, tell me how these arguments could be anything other than misogynistic nonsense?

        3. amblingalong
          amblingalong February 6, 2013 at 2:00 am |

          The point I was trying to make is that if it were true that working in prostitution can all be boiled down to the making of an individual choice (and thus the oppression of women and non-whites has no relationship to the issue at all), then you would THINK that there’d be at least some white hetero males making this “choice” too. But are there even any?

          Nobody is arguing that patriarchy and misogyny (and transphobia and racism and homophobia and ableism and classim) don’t intersect with sex work at all. Patriarchy and misogyny and all the myriad forms of discrimination intersect with almost every career there is; people are not portraying sex work as a rosy oppression-free zone. None of that means the careers themselves are bad; it’s the oppression that’s bad!

          I presume you’re ok with the existence of nursing, right? Nursing is not an evil career to have, just because women do it more than men, and it has less status/pay than being a doctor. What’s wrong are the social forces that push women towards nursing and men towards med school. Same goes for sex work.

        4. Elle Fury
          Elle Fury February 6, 2013 at 8:41 am |

          I shouldn’t have mentioned social class when I made my point about white hetero males as there are obviously many jobs rich people (including rich women) wouldn’t do. i.e. work at Burger King

          The characteristics I should have isolated only are: male, white, hetero, as even those from poor or working class backgrounds do not “choose” prostitution as a “career”.

          OK, except for like the 5 you linked me to, which I should have acknowledged because I forgot I am debating individualists who are unable to discuss overall patterns and see the bigger picture. (I’ll have to remember this next time I bring up discussions about the beauty industry and wearing makeup, because ya know, there might be a few hetero males out there who wear makeup too, so I can never say ‘men don’t wear makeup’ lest I leave out a few exceptions to the rule!)

        5. macavitykitsune
          macavitykitsune February 6, 2013 at 11:34 am |

          there might be a few hetero males out there who wear makeup too, so I can never say ‘men don’t wear makeup’ lest I leave out a few exceptions to the rule!

          Congratulations on erasing large parts of Asian, African and Oceanian cultures where makeup (though not the blush-foundation-etc that North Americans are accustomed to) is perfectly acceptable for men.

          Have you considered doing any reading on places outside the USA? You can start with Wikipedia.

    3. Tyris
      Tyris February 6, 2013 at 1:19 am |

      Supply and demand. There’s nobody willing to pay for sex with a white middle or upper class heterosexual male, not when there are so many of them giving it away for free.

      1. Elle Fury
        Elle Fury February 6, 2013 at 1:48 am |

        Not true.

        I’m sure there are a lot of lonely unattractive females with money who would love the opportunity to have sex with an attractive man.

        And everyone says that all men love having sex- so it would seem like a great money making opportunity for them! They can do something they LOVE and make money!

        So where are they?

        1. macavitykitsune
          macavitykitsune February 6, 2013 at 1:56 am |
    4. jemima101
      jemima101 February 6, 2013 at 3:22 am |

      Erm…supply and demand. When there is equality, no lut shaming and no whore phobia perhaps rich women will pay for sex with white cis men.

      Oddly in a patriarchal society the people who have the money time and lack of social stigma to pay for sex are men.

      Wanders away very confused at having to explain this….

      1. konkonsn
        konkonsn February 6, 2013 at 11:10 am |

        No kidding. My parents are freaked out by the thought of sex toys and female masturbation (and when my sister began living with her boyfriend…don’t get me started). I’ve actually been really interested in the idea of sex work, but I wouldn’t be able to deal with their response. Also, I have some medical issues that would make it difficult.

    5. LotusBecca
      LotusBecca February 6, 2013 at 4:08 am |

      Why the hell do you think? Do you see elite white men choosing to be coal miners? Garbage collectors? Home health care workers? Migrant farm laborers? No? Well, probably it’s because generally these jobs (as well as sex work) are low-wage, low-status, and shitty, and elite white men are privileged and have better opportunities.

      Now does this mean we should throw coal miners, garbage collectors, home health care workers, and migrant farmers laborers in jail? Or perhaps we should just arrest the people who buy tomatoes picked by farm workers, or just arrest the people who pay for garbage collectors to come by their house and pick up the trash every Friday. I’m certain that these low-wage, low-status workers would really appreciate our help with that, as it would really enable them to “escape” their shitty circumstances and become normal people.

  18. Ismone
    Ismone February 5, 2013 at 10:38 pm |

    I read the article mentioned by the posters last week, and now have read their post. Then I went and googled Steinem, and what she said, since she was the only feminist who was mentioned by name that has ever been on my radar. Frankly, if I had time, I would google the rest of the activists and see if they are feminists or Palin-feminists.

    Here are two excerpts from the GS article that I think are important. Whether or not you think she is right, I do not think the article fairly represents her views.

    1) Regarding “ending HIV programs”–I disagree that is what GS advocated, I think she instead is criticizing how a program operates. Here is the whole paragraph:

    “It’s very hard to look at women — or men — treated as if they were objects, as if they have no feelings, no will of their own. Their phrase in many countries is ‘survival sex’. It’s very painful to watch. I feel guilty as an American because I know the Gates Foundation has been paying huge sums — at least $500 million so far — to AIDS control programmes in India that pay salaries to brothel owners and pimps and traffickers in Sonagachhi and Sangli to become ‘peer educators’ and distribute condoms, though there’s no proof that women have the power to make men use condoms, and there is proof that men pay more to have sex without a condom.”

    2) GS is advocating for decriminalization instead of legalization:
    “Experience now reveals that what works — and has worked in Nordic countries, where trafficking has actually diminished — is to de-criminalise the women or men who are prostitutes, offer them services and practical alternatives, and prosecute the pimps, traffickers and brothel owners to the full extent of national and international law. After all, there is a greater percentage of the world’s population in slavery now than there was at the peak of the slave trade — with sex slavery about 80% and labour slavery about 20%, according to the UN, though the line between the two is sometimes academic.

    The point is: you may have a right to sell your own body, but you have no right to sell the bodies of others. We must stop arresting the victim. In Nordic countries, they fine and educate the customer, not just to embarrass him, but to give them the facts of human trafficking for which he is part of the market.”

    http://www.telegraphindia.com/1120422/jsp/calcutta/story_15393912.jsp#.URHJbejZrqs

    I happen to be one of those people who doesn’t think that money cannot ethically buy consent (notice I said buy consent), and so I think people who purchase sex are behaving unethically. Should it be illegal? I don’t know. I also favor harms reduction, so if legalization does a better job of that than decriminalization, I am in favor of legalization.

    But I do not think that people who are in favor of decriminalization want to harm women, men and children who are the “sellers.” I think it is a good faith argument to have in the feminist community.

    1. jemima101
      jemima101 February 6, 2013 at 3:18 am |

      Ahhh the I only want to save you argument. What if sex workers dont want to be saved by people who look down on them?

      Sex workers oppose the Nordic Model, it endangers them (read the pro senet report) denies them bodily autonomy and pushes them into more dangerous choices.

      You know that should be enough, we dont want it.

      1. Bagelsan
        Bagelsan February 6, 2013 at 3:08 pm |

        Yes, “sex workers” the monolith. Because that makes sense.

      2. Ismone
        Ismone February 7, 2013 at 12:29 am |

        I only want to stand in solidarity and prevent harm.

        And the group GS toured with was a group founded for sexworkers, by sexworkers.

      3. Ismone
        Ismone February 7, 2013 at 5:26 pm |

        Just want to touch base and say that I would have written this post differently or not at all after the articles you and others posted on the other thread.

        A lot of food for thought. Thank you.

  19. Foxy
    Foxy February 5, 2013 at 11:24 pm |

    Simplistic article.There are places in the world where prostitution is legalised but it didnt reduce sex trafficing

    1. thinksnake
      thinksnake February 6, 2013 at 1:07 am |

      Citation needed.

      I live in one of the jurisdictions (New South Wales) where sex work is decriminalised (note: NOT legalised), and know a lot of people who work in/have done sex work.

    2. jemima101
      jemima101 February 6, 2013 at 3:20 am |

      There is only 1 (holland) and it is a model no one is suggesting emulating

  20. lane
    lane February 6, 2013 at 1:05 am |

    Here’s another of those disgusting hater blogs. I mean who do they think they are?

    http://soul-destruction.com/voices-of-prostitution-survivors/#The-Magic-Number-18

    1. macavitykitsune
      macavitykitsune February 6, 2013 at 2:02 am |

      Yes, survivors of forced prostitution and sex trafficking are exactly the same as consensual sex workers. In exactly the same way as I have sex with my wife, and it’s magically exactly like rape because reasons.

    2. Li
      Li February 6, 2013 at 2:57 am |

      No one is arguing that women cannot have a fucking horrific experience of sex work. Or that coercion and exploitation do not happen and that if they do women aren’t traumatised by them. Women can absolutely experience sex work as traumatic. What we are resisting is the idea that all sex workers are damaged and exploited, and that those sex workers who don’t report a traumatic experience of their work are just too stupid or brainwashed to understand their own lives.

  21. PeggyLuWho
    PeggyLuWho February 6, 2013 at 1:54 am |

    This whole thread needs this – http://www.unnecessaryquotes.com/

    1. macavitykitsune
      macavitykitsune February 6, 2013 at 2:00 am |

      I love you.

      1. PeggyLuWho
        PeggyLuWho February 6, 2013 at 2:01 am |

        I love you, too.

  22. mistress matisse
    mistress matisse February 6, 2013 at 2:24 am |

    A staple of anti-sex worker rhetoric: “No one could ever possibly CHOOSE to do sex work. And if you say you do, then I say you’re either deluded or you’re a pimp, so you don’t count. So I remain fast in my belief that NO ONE CHOOSES TO DO SEX WORK.”

    Also, just for the record: men do sex work. There’s the M4M workers, of course. But there are also male sex workers who see female clients. Not as many as women, but still. It’s less talked about because oh, maybe, there’s a huge stigma about anyone seeing sex workers and – who’d have thought? – women have historically had more restrictive social rules placed on their sexual behavior than men have. So the culture of it is still emerging. But I know several (white cis non-trafficked adult) men who do this as a substantial part of their income.

    I’ve been a sex worker for over 20 years, and I myself have seen a number of female clients in that time, as have all of my sex worker friends. While I no longer take on new clients, I still get regular requests from women for my services. So – that happens.

  23. rw1982
    rw1982 February 6, 2013 at 2:26 am |

    I think this is kind of indicative of a larger rift in the SJ movement. It seems that the larger movement can kind of take or leave white, cis women. The CATW advocates the Nordic model. There is very little evidence that even an end to prohibition would stop pimp or brothel control of these women (Holland is a good example of this). I think it comes down to power. I think it’s important for organizations like CATW to get more powerful so that they can actually combat traffickers. The problem, as I see it, is the justice system itself. 15 billion dollars was spent on the drug war in 2010, for trafficking we’re talking millions. For me, it’s a will issue. Legalization just isn’t keeping people safe and in many cases Russian mobsters and other criminals are coming in to these European countries that have legalized and they’re just using the legal framework to brutalize women.

    As with anything that can be construed as a choice argument, people advocating action are going to get some shit for it. Some times you have to hurt to help but CATW, countries like Sweden, etc. are also dedicated to helping sex workers get out of the industry.

    This is just a case where traditional feminist movements are going to have to stand against the SJ forces and I don’t see any other way around it. Ending prohibition has been shown not to work. It’s a will issue, and the ambivalence needs to end. I think the ambivalence needs to end but that doesn’t change who is right in this situation.

    Commodification of sex hurts all women and in the war against this commdification, some women involved in it are going face negativity. If We end the sex trade, generations of women are going to benefit, the needs of the many just outweight any accidental negativity that happens getting it done. The police need to be held accoutable, absolutely men using these services need to face stiffer penalties. It should be a felony, there should be mandatory jail time. Women providing these services should be taking mandatory skills classes, they should be incentivized to get their high school diplomas, to get a trade or college. I agree that anti-traffickers need to be more sympathetic and we need to treat these women as our sister and mothers, they’re victims not criminals. Law enforcement being what it is, it will always be a problem but with hard work, we can change the culture of vice and law enforcement. Just because legal bueracracy is traditionally unneffective, doesn’t mean We can’t force it to work if we try hard enough. It’s a will issue and if it causes a greater rift bettween feminst and sj circles it is unfortunate. One argument I would make however is that the larger progressive social justice community should stop using issues such as this as an avenue to shame cis, white feminist who simply disagree with their positions. The social justice community is fractured over so many things (islamofascists, sex work, misonogy in the trans and gay communities, etc.) and it seems as though feminists, especially white, cis feminists are just meant to accept this stuff and not comment on it. At the same time, it would be regrettable if this did lead to a long standing fracture as it would be much more difficult for all of the communities involved in the SJ movement to effectively combat the establishment.

    If you see someone’s beautiful daughter, one of your beautiful sisters being reduced to an object, her very being turned into a commodity, how can that be ok? I basically can’t stand by and watch her be basically forced to flog herself like a can of soda (I’ve seen the ads on backpage,) and I don’t understand. How could we want this to exist. We need to save these women, from themselves if neccessary.

    1. jemima101
      jemima101 February 6, 2013 at 10:48 am |

      I just cannot, the arrogance, fail and sheer hatred for women in this…please someone else with the spoons take this one on. I am shaking after reading it.

      Oh and yeah, thanks for the proof that some feminist are anti sex worker.

      1. konkonsn
        konkonsn February 6, 2013 at 11:24 am |

        I want to jemima101, but I just keep re-reading that last paragraph, and my will gets sapped because there’s so much ignorance and wrong there that this commenter really needs a couple of months of Feminism 101 lesson plans.

        I will say in relation to this:

        Women providing these services should be taking mandatory skills classes, they should be incentivized to get their high school diplomas, to get a trade or college.

        and this:

        We need to save these women, from themselves if neccessary.

        It basically feels like listening to fucking US Republicans talking about how if poor people JUST TRIED HARDER they could get jobs and wouldn’t need their damn gubberment handouts. Because LOGIC dictates that if all sex workers don’t want to be there, and if they aren’t being kept by literal shackles, it’s just because they aren’t TRYING HARD ENOUGH to get a RESPECTABLE job.

      2. A4
        A4 February 6, 2013 at 11:28 am |

        I too just don’t know how to respond to that kind of screed. Treat them like our mothers and sisters? Mandatory skills classes? The glorious liberative ends justify the damaging abusive means? Poor straight cis white women getting bullied by the people whose lives they’re theorizing about?

        FFS!

      3. Li
        Li February 6, 2013 at 11:44 am |

        jemima101, I’m holding off a more in depth response because I’m having trouble not having the toxicity of the comment’s premises infect anything I write, but I do want to reiterate what LotusBecca said earlier and state how grateful and impressed I am at the continued engagement of yourself and other sex workers on this thread, especially in the face of this kind of egregious bullshit, and that I’ve really appreciated reading your thoughts.

        1. jemima101
          jemima101 February 6, 2013 at 5:18 pm |

          Thank you :-) Various people have said urgh feministe and I have replied, NO, there are awesome allies there.

          I do have 2 words for the poster though. Magdelene Laundries.

    2. Li
      Li February 6, 2013 at 11:31 am |

      I agree that anti-traffickers need to be more sympathetic and we need to treat these women as our sister and mothers, they’re victims not criminals.

      If We end the sex trade, generations of women are going to benefit, the needs of the many just outweight any accidental negativity that happens getting it done.

      One argument I would make however is that the larger progressive social justice community should stop using issues such as this as an avenue to shame cis, white feminist who simply disagree with their positions.

      If your “sympathy” consists of “I am willing to sacrifice you in order to benefit more privileged women”, you’re fucking doing it wrong.

    3. Donna L
      Donna L February 6, 2013 at 12:33 pm |

      misonogy [sic] in the trans . . . communities

      We all know what this means, don’t we? Those awful “trans women” trying to invade women’s spaces and pretend that they’re real women! Misogyny!

      I’m beginning to think that “abolitionism” and the radical feminist anti-trans ideology really are two sides of the same coin, and that there’s a one-to-one correspondence between the advocates of both.

      1. rw1982
        rw1982 February 6, 2013 at 4:15 pm |

        Donna, I’m perfectly willing to view trans women as sisters just as that is essentially my default attitude toward any woman, because it’s powerful. Regardless of what people on the Internet may say, We’re at war right now and We need everyone on deck. If you’re not even willing to acknowledge mysogyny in the trans community then that’s a problem. If your goal is to essentially fracture the movement then we have a problem. I’m out in the community, I’m trying to help. I’m trying to save people and until everyone is saved, until the good girls win, rhetoric that attempts to fracture the movement is unhelpful, that is not to say that many avowed feminists have views on this subject that are disgusting to me and likely even more disgusting to you. There is a war on women, and that’s a war we have to win. When you’re in a war you don’t have time to talk about how everything makes you feel. When you’re out there like me, saving people, then you can criticize me and I’d give that advise to all my other sisters out their who identify as trans.

        1. macavitykitsune
          macavitykitsune February 6, 2013 at 4:22 pm |

          If you’re not even willing to acknowledge mysogyny in the trans community then that’s a problem.

          I imagine that trans women have exactly the same degree of internalised misogyny (in general) as cis women or female-bodied genderqueer people. I don’t see why they need to be singled out for misogyny.

        2. macavitykitsune
          macavitykitsune February 6, 2013 at 4:23 pm |

          When you’re out there like me, saving people, then you can criticize me and I’d give that advise to all my other sisters out their who identify as trans.

          Also, you have this idea that you’re the only one out there saving people while the rest of us fuck around on the internet. Correct yourself. Immediately.

    4. Combray
      Combray February 6, 2013 at 1:11 pm |

      If you see someone’s beautiful daughter, one of your beautiful sisters being reduced to an object, her very being turned into a commodity, how can that be ok? I basically can’t stand by and watch her be basically forced to flog herself like a can of soda (I’ve seen the ads on backpage,) and I don’t understand. How could we want this to exist. We need to save these women, from themselves if neccessary.

      Drawing a comparison between sex work and “being reduced to an object” speaks volumes about your view of women and their sexuality. Sex workers provide a service in exchange for money, which is what most of us do at work. And as for saving women from themselves? There’s just not enough vomit in the world.

      1. rw1982
        rw1982 February 6, 2013 at 4:28 pm |

        Most of us are not working jobs that provide no recourse if We are physically or sexually abused. Go on backpage and tell me what it looks like? They look like car ads; Asian/23/100h 150hh/I love white boys/etc. Don’t forget to ask about the 2 girl special. This has to stop. We can’t let anyone talk about women this way, it simply cannot be allowed to happen. The fact of the matter is, it isn’t going to be any less unseemly if its legalized. I’ve forced myself to sit through some porn; with these monsters choking, slapping women and laughing. I don’t care who is ok with it. I’m not ok with it, no one should be ok with it. This is a human being’s sexuality, it isn’t soap suds.

        I apologize if the saving thing sounded gross. I don’t know how else to word it. Sometimes you have to help people even they don’t want to be helped. We all have a moral compass. If something is wrong, it’s wrong, if someone needs help, they need help.

        1. macavitykitsune
          macavitykitsune February 6, 2013 at 4:33 pm |

          Sometimes you have to help people even they don’t want to be helped. We all have a moral compass. If something is wrong, it’s wrong, if someone needs help, they need help.

          Um, that`s a fair amount of paternalism. Just saying.

        2. Combray
          Combray February 6, 2013 at 5:05 pm |

          No one is denying the plethora of issues surrounding sex work. You’re only adding to the problem, however, when you suggest that by virtue of their profession, sex workers are objects and commodities. What they are is service providers. The fact that the service is sexual in nature doesn’t imply that their “very being [is] turned into a commodity”, unless you believe that women can be reduced to their sexuality.

          I apologize if the saving thing sounded gross. I don’t know how else to word it. Sometimes you have to help people even they don’t want to be helped. We all have a moral compass. If something is wrong, it’s wrong, if someone needs help, they need help.

          The problem is with the sentiment, not the wording. If someone is telling you they don’t want or need the kind of help you’re pushing on them, maybe you should listen.

  24. Lisa Hendricks
    Lisa Hendricks February 6, 2013 at 4:36 am |

    STOP the RAPE and ABUSE of WOMEN in INDIA
    Boycott India Campaign

    As many of you may be aware, a couple of months ago on December 16, 2012, a 23 year old female medical student was gangraped by 6 men in New Delhi, India. Aside from this very prominent case, the abuse and rape of women in India remains an everyday occurance, and the Indian government refuses to do anything to stop this problem. Also, recent news articles that interviewed Indian men report that up to 50 PERCENT of Indian men actually JUSTIFIED the rape, saying it was “her fault” for being out so late at night, or that it was HER FAULT for being dressed in western clothes instead of in traditional female indian clothing. Clearly, both the government of India, and a large majority of the COMMON MAN of India supports and condones the RAPE and ABUSE of WOMEN in India.

    It is now time to start voting with our feet and with our purses. We should no longer support or buy products from India, as the society and government promotes the rape and abuse of women. We need to BOYCOTT INDIA, and refuse to buy products that are produced in India.

    Here is a list of American companies that have branches or offices in India. We must DEMAND that these American companies withdraw all their branches and offices from India IMMEDIATELY and REFUSE to do business with a country that condones and promotes the abuse and rape of women.

    Nike
    Ford
    General Motors
    Bank of America
    Citibank
    Goldman Sachs
    JPMorgan
    Avon
    Mary Kay Cosmetics
    Coca-Cola
    PepsiCo
    Timex
    Pfizer
    IBM
    Kodak
    Gillette
    Kellogg
    McDonalds
    Pizza Hut
    KFC
    Dominos Pizza
    Taco Bell
    AT&T
    Motorola
    Hilton Hotels
    Hyatt Hotels
    Marriott Hotels
    Colgate Toothpastes
    American Airlines

    Boycott the above companies and refuse to buy their products. As long as India remains a country that promotes and supports the abuse and rape of women, we should not support any company that does business in India.

    The next time you are buying a product at a store, check if it is made in India. If so, refuse to buy the product and buy a different product that is not made in India instead.

    The government and society of India has made it very clear that it supports and promotes the abuse and rape of women. Until this anti-woman policy changes, we should literally boycott India and cut all economic ties with India. We can start this Boycott India Campaign by following the above steps.

    Please post this on your Facebook Wall, on your personal blog, or email it to all of your friends. The more people who engage in the Boycott India Campaign, the faster we can end the abuse, rape, and oppression of women in India.

    1. Li
      Li February 6, 2013 at 11:24 am |

      Oh, macavitykitsune is going to eat you alive.

      1. PeggyLuWho
        PeggyLuWho February 6, 2013 at 11:46 am |

        I’m getting my popcorn ready.

        1. macavitykitsune
          macavitykitsune February 6, 2013 at 11:53 am |

          Aww, you guys. I was boiling with rage reading that and now I’m all *FUZZ*. ♥

        2. PeggyLuWho
          PeggyLuWho February 6, 2013 at 12:13 pm |

          I have a huge crush on you right now.

    2. macavitykitsune
      macavitykitsune February 6, 2013 at 11:47 am |

      Wait, are you posting this on the right thread? I fixed it for you tho! ^__^

      STOP the MURDER AND ABUSE of black men in THE UNITED STATES!

      As many of you may be aware, a few months ago, a young black man was shot by a white man in the United States for walking through his neighbourhood. Aside from this very prominent case, the incarceration and murder of black men in the US remains an everyday occurance, and the US government refuses to do anything to stop this problem. Also, recent news articles that interviewed white Americans report that A LARGE PORTION of them are saying it was “his fault” for being in the wrong neighbourhood, or that it was HIS FAULT for being dressed in a hoodie instead of traditional respectable clothing like a suit. THE MURDERER IS STILL OUT ON PROBATION. Clearly, both the government of the US, and a large majority of the COMMON MAN of the US support and condone the ABUSE and MURDER of black men in the US!

      It is now time to start voting with our feet and with our purses. We should no longer support or buy products from the US, as the society and government promotes the abuse and murder of black men and has HISTORICALLY ENSLAVED THEM. We need to BOYCOTT THE USA, and refuse to buy products that are produced in THE USA.

      Here is a list of American companies that have branches or offices all over the world. We must DEMAND that these American companies withdraw all their branches and offices from the world IMMEDIATELY and REFUSE to do business with a country that condones and promotes the abuse and rape of women.

      Boycott the above companies and refuse to buy their products. As long as THE US remains a country that promotes and supports the abuse and murder of black men, we should not support any company that does business in the US.

      The next time you are buying a product at a store, check if it is made by a US company. If so, refuse to buy the product and buy a different product that is not made by the US instead.

      The government and society of the US has made it very clear that it supports and promotes the abuse and murder of black men, as well as imperialist campaigns against brown men in Pakistan and Iraq. Until this racist and slavery-justifying policy changes, we should literally boycott the USA and cut all economic ties with the US. We can start this Boycott USA Campaign by following the above steps.

      Please post this on your Facebook Wall, on your personal blog, or email it to all of your friends. The more people who engage in the Boycott USA Campaign, the faster we can end the abuse, incarceration, and murder of black men in the USA.

      (Also, US lady, I fixed your grammar here and there. Don’t bother thanking me, it’s just my duty as a humble brown person.)

    3. Donna L
      Donna L February 6, 2013 at 12:38 pm |

      Are there any countries that shouldn’t be boycotted under this approach? San Marino? Andorra? Liechtenstein? Vatican Ci– no, never mind that one.

    4. macavitykitsune
      macavitykitsune February 6, 2013 at 12:53 pm |

      All right, now for the actual takedown.

      First: Look here, you ignorant little shit. You point me to any country that doesn’t condone rape and abuse of women. Go ahead, find one, I’ll wait. 1 in 4 US women experience sexual assault or sexualised abuse (sexual abuse, domestic violence from an intimate partner etc). It’s about the same rate for India, by the way (it’s reported way less but there’s an acknowledged issue of underreporting). Pick another country and off we’ll go.

      Second: Remember that gang-raped kid in Texas? The one who was raped by a dozen people? 11 years old? And they were still discussing her clothing. Again, I’m assuming you’re from the US, but feel free to point out another country of your choice and I’ll find you the same dirt there.

      Third: Fascinating. By all means, boycott the brown people’s places! Stop visiting the brown people’s places! But, you know, ideally, go back in time and stop people from 1600/1492/1630 visiting the brown people’s places! That’s when many of us got such charming relics of your culture such as laws against homosexuality, heaping doses of legal transmisogyny, criminalising sex work, etc, etc.

      Fourth: Uh, just fuck you. I could go into the economics of this situation, but that’s not my area of specialty and I’d probably communicate ineffectively. I’ll leave that to any of the dozen or so people here who are really into that sort of thing. Though honestly for them it’d be like shooting fish in a barrel, if the fish were pickled herring.

      Fifth: God, could you at least grammar? Rudyard Kipling knew to grammar!

      1. Ismone
        Ismone February 7, 2013 at 5:29 pm |

        I know we have been scrapping, but all the same, awesome fucking post. Just awesome. Thank you for this.

        1. macavitykitsune
          macavitykitsune February 7, 2013 at 5:47 pm |

          Ismone, I don’t think we were scrapping. Like i said there, before I bowed out, you’re right that I misunderstand/misstate and then don’t apologise even when I walk my statements back, and I’m trying to fix that (irl as well as online; I’m consistent if nothing else). I’ve got no issues with you. I just think that rox is incredibly disingenuous (I’ve seen her pull some seriously shady shit at other people on other threads too) and I don’t have much patience where she’s concerned.

  25. Carolyn in Baltimore
    Carolyn in Baltimore February 6, 2013 at 7:44 am |

    This ‘article’ is so full of untruths. No feminist I know blames women for choices they make to survive patriarchy. And most ‘sex workers’ ‘choose’ that work because of necessity. Or are trafficked.
    All feminists I know advocate the Nordic model – which criminalizes the demand and offers services to ‘sex workers’. Countries using this model have seen a sharp decrease in trafficking and other related crime. Countries like Germany and Holland, that have basically legalized prostitution have become overrun with trafficking and drugs and crime.
    Feminists don’t like the system of anyone objectifying and using the bodies of oppressed persons. The system is stacked against the victims. You may not like feminist analysis of trans activism but we work for all women.

    1. jemima101
      jemima101 February 6, 2013 at 10:45 am |

      Read the motherfucking comments

    2. Katniss
      Katniss February 6, 2013 at 12:26 pm |

      I am asking this seriously:

      Why did you use scare quotes around “choice” and “sex workers”? What benefit did you think that would bring to the conversation? And do you realize that by doing so you’ve been extremely condescending to the sex workers posting here?

      1. Carolyn in Baltimore
        Carolyn in Baltimore February 6, 2013 at 12:48 pm |

        Because I don’t think sex workers have true agency. There are many reasons that people will prostitute themselves, but the ones who choose that as a job are a tiny minority. Almost all of the accounts I’ve read by exited sex workers say they also drank the koolaid and thought they chose it. I do not like the phrase sex worker. It is the kind of job where you have to give up your humanity. Most trafficked people are started at 12-14 years old, many younger. They not only don’t have agency – it is rape.
        Criminalize demand, arrest the johns, and the problem will be greatly diminished.

        1. Caperton
          Caperton February 6, 2013 at 12:58 pm | *

          Please remember that there are several sex workers commenting on this thread right now, and that while they certainly can’t speak for all sex workers, they can speak for themselves. While you’re denying their agency and speculating about their Kool-Aid consumption, you’re doing so to their faces.

        2. Katniss
          Katniss February 6, 2013 at 1:07 pm |

          I don’t think it’s ever okay to deny people their agency in this way.

          Look, I’ll level here: I spent some time as a sex worker and for me it was extremely unhealthy. I was not in a good place at the time and it wasn’t the best choice for me.

          But I STILL had agency. I still made a choice, even if it is one I wish I hadn’t made. Even with my situation, I am offended and hurt by your use of scare quotes around the word choice because it removes the fact that I am and always have been a person with complex emotions and reasons behind my choices…instead you are turning me into a cipher for what you see as an inherently abusive situation. In essense you are denying my humanity.

          Given that I’m someone with a bad history when it comes to sex work, I can’t imagine how your agency-denying language makes the sex workers here who truly did choose their work and enjoy it feel.

        3. moviemaedchen
          moviemaedchen February 6, 2013 at 4:16 pm |

          It is the kind of job where you have to give up your humanity.

          Did you seriously just call sex workers inhuman?

          Fucking fuck is that offensive.

        4. macavitykitsune
          macavitykitsune February 6, 2013 at 4:20 pm |

          Because I don’t think sex workers have true agency.

          Because I don’t think poor people have true agency.

          Because I don’t think lesbians have true agency.

          Because I don’t think POC have true agency.

          Yeah, I’ve heard this song before. Fourth verse, same as all the other ones, right? SAVE THEM FOR THEY KNOW NOT WHAT THEY DO.

  26. Elle Fury
    Elle Fury February 6, 2013 at 9:02 am |

    you know sex is magic, and unlike any other activity that human beings engage in, so it can’t be like cooking a burger

    Interesting that you compare sex to cooking burgers….

    So if someone locked you in a kitchen and forced you to cook burgers you would feel the same physical and emotional distress as you would if someone locked you in a bedroom and raped you? Because, by your logic, both would be examples of “forced labour” and “theft of services”, right?

    1. mistress matisse
      mistress matisse February 6, 2013 at 9:15 am |

      Elle Fury, I see that the food comparison isn’t working for you. How about this: Frame any argument you choose about why sex work should remain criminalized – and then remove the phrase “sex work” and replace it with the word “marriage”. It will still be just as accurate. The list of bad things that can happen to women in marriage is long. Marriage is historically a system of male ownership and control of women, and many people still treat it as such. Married women report higher levels of stress and depression than single women. Many women are abused by husbands. Women can contract STD from their husbands. Women are pressured or coerced into marriage, get married too young, or to men they don’t love, or stay married when they don’t really want to for financial reason or because they are intimidated or coerced into doing so. Should we then arrest any woman who wants to get married to “rescue” her? That’s obviously ridiculous, right? We recognize that each woman has an individual experience of marriage and that her experience might be just fine. I’m a sex worker. I do not support anyone being abused or raped or held captive. I would report any instance I saw of that. And I support any organizations that offers help to anyone who wants to leave sex work, just the way I support organizations that help women that want to get away from abusive husbands, but the keyword is want.

      1. wembley
        wembley February 6, 2013 at 10:47 am |

        [TRIGGER WARNING: graphic rape imagery (TW added by moderator)]

        I believe in decriminalization, Mistress Matisse (and love when you guest star on the Savage Lovecast, if you’re the same one), but the “sex work is just another type of work because sex isn’t magically different” argument isn’t working for me, no matter what it’s arguing *for*. And I get that working in a dungeon is way different than working on the street. But, okay: my best friend works in a cubicle. She’s threatened with firing if she doesn’t meet impossible production quotas. She “chooses” to work overtime for no overtime pay at times because she knows if she doesn’t, she won’t meet production and will get fired. I’m pretty sure that’s illegal? But she can be pretty secure in the knowledge that no man will force his dick into her vagina against her will while she’s working, or murder her at her cubicle. I’m not saying it could NEVER HAPPEN, but it’s pretty goddamn unlikely.

        I just… I feel like the commetariat here is ignoring some pretty obvious realities to overcompensate for the shittiness of pro-decriminalization douchebags.

        Also, if a central tenet of social justice, as I’ve come to understand it, is that you center discussions around the most oppressed faction of the group, then shouldn’t these discussions be centered more around trafficked sex slaves, sex workers engaged in survival sex, sex workers essentially enslaved by pimps, and sex workers without pimps who nonetheless don’t have much of a choice engaging in their work?

        1. PeggyLuWho
          PeggyLuWho February 6, 2013 at 12:28 pm |

          TRIGGER WARNING GODDAMMIT

        2. mistress matisse
          mistress matisse February 6, 2013 at 3:04 pm |

          But so many of the risks of sex work that you point out could be substantially reduced/eliminated if it were entirely decriminalized. The risk of assault, for example, is GREATLY reduced when women do not work alone, but can work in teams of their own choosing, who are trusted friends. (Or they can hire a male guard – who is THEIR employee, not a pimp- to be within earshot.) If they do that under current law, they may be charged with a felony. So it’s more of a crime to have people around you to help you.

          And sex workers who are there by choice are very well positioned to see people who are being exploited. If we did not fear our own arrest, we’d be far likelier to report someone we thought was where she/he shouldn’t be, and in danger, and try to get that person some help.

          There’s just nothing about having women fear arrest that makes them safer from any of the negatives about sex work as it stands now. The first step to making life better for women is to stop arresting and jailing them for sexual behavior. That’s the system that we have in place now, and it harms women a GREAT deal more than it protects them.

        3. wembley
          wembley February 8, 2013 at 9:45 am |

          Mistress Matisse – I agree with you, though! I agree in de-criminalization! My issue was more with the meta-discussion — who these conversations center. That said, your point about Spelunking Sex Workers in a better position to see who’s being exploited is one I hadn’t thought about, so it’s yet another reason why I agree with you about decriminalization.

          I’d also be cool with a law that makes it illegal to pimp but not illegal to be someone who engages in sex work though I have no idea how the hell that would work in practical terms, or how that would keep, like, managers of dungeons and such from being caught in the same net, etc., so. :/

      2. the_leanover
        the_leanover February 6, 2013 at 10:58 am |

        I’d be pretty up for abolishing the institution of marriage tbh. Not got much of a game plan on that though

        1. Elle Fury
          Elle Fury February 6, 2013 at 11:40 am |

          Exactly, the_leanover. Most radical feminists who oppose the sex industry also oppose the institution of marriage.

          Should we then arrest any woman who wants to get married to “rescue” her?

          And, I’m sorry, but how many times do abolitionists have to say WE DON’T WANT TO PUT PROSTITUTED WOMEN IN JAIL! Jail is where the pimps and johns belong.

        2. amblingalong
          amblingalong February 7, 2013 at 5:48 pm |

          WE DON’T WANT TO PUT PROSTITUTED WOMEN IN JAIL!

          Just to be clear, who is ‘prostituting’ the women? Because obviously their fluffy little lady-brains aren’t capable of doing it themselves.

      3. wembley
        wembley February 8, 2013 at 9:39 am |

        I apologize for the lack of trigger warning, Peggy and everybody! I really should have put one, that was really thoughtless. :(

        1. tigtog
          tigtog February 8, 2013 at 6:15 pm | *

          I have added a trigger warning to the comment in question.

      4. wembley
        wembley February 8, 2013 at 9:40 am |

        And whoops, I meant PRO-CRIMINALIZATION/ANTI-DECRIMINALIZATION douchebags, ack ack ack! This is what I get for posting in the heat of the moment in a rush to get to work. Goddammit.

    2. jemima101
      jemima101 February 6, 2013 at 10:05 am |

      Locking someone is a kitchen and forcing them to cook isnt distressing in your world. Explains why rad fems rarely fight against domestic slavery .

      http://www.antislavery.org/english/campaigns/home_alone/stories_of_domestic_workers/indra_and_divia.aspx

      Tell these women their trauma is not important to you.

      1. the_leanover
        the_leanover February 6, 2013 at 10:55 am |

        I agree that we should be talking about all trafficking and forced labour, not just the sex kind. But here’s a better example of what I think Elle’s trying to say, and one that illustrates why the ‘sex work is no different to burger-flipping, lots of people hate their jobs’ line tends to make me uncomfortable: in many countries, if someone is receiving government unemployment benefit, they are required to apply for a certain number of jobs, and if they repeatedly turn down jobs that they are offered, their benefits will be reduced or removed. Fair system? Well, debatable. It could certainly be considered a form of economic coercion, and lots of the jobs/industries that people are coerced into working in are for sure exploitative. But I can’t help but find it different for someone to end up flipping burgers even though they don’t want to, and someone to end up having sex for money even though they don’t want to. Do you find those things to be equivalent? This isn’t an argument for criminalisation, and I’m not trying to suggest that there’s any likelihood of this particular scenario arising or that anyone would advocate it, and I’m sure there are plenty of people who would prefer to take the sex work option than the burger-flipping one. But it’s an analogy about why, for me, the argument that amblingalong uses upthread that ‘even the people who hate being sex workers aren’t being de facto exploited any more than people who hate being burger-flippers’ does not sit well with me. I think people who hate being sex workers but are economically coerced into being so are more exploited than people who are economically coerced into being burger flippers. Maybe I’m wrong. But feeling pressured into sex that you hate is generally considered by feminists to be qualitatively worse than being pressured into doing other things you hate. If the boss forces you to clean the toilet on unpaid overtime under threat of firing, that’s exploitative, but it’s not the same as if your boss forces you to give him a blowjob under threat of firing. Again: this isn’t a suggestion that there aren’t plenty of women who would rather be sex workers than flip burgers, or about who’s ‘representative’; it’s only an argument against the idea that we can conceptualise sex work as precisely equivalent to any other form of labour (unless you’re also fighting on the platform that nobody should ever have to do any form of labour they don’t feel comfortable with. Which I’d be on board with, btw.)

        1. Elle Fury
          Elle Fury February 6, 2013 at 11:43 am |

          Thanks, the_leanover. You said it much more eloquently than I did. And your example of sexual harassment is an excellent one.

        2. Fat Steve
          Fat Steve February 6, 2013 at 1:20 pm |

          If the boss forces you to clean the toilet on unpaid overtime under threat of firing, that’s exploitative, but it’s not the same as if your boss forces you to give him a blowjob under threat of firing

          Yes, one involves you getting on your knees, humiliating yourself and coming into close contact with his most intimate of bodily fluids, and the other…ummm….

      2. Elle Fury
        Elle Fury February 6, 2013 at 12:16 pm |

        OMG, jemima101, you are a master at derailing conversations or just have terrible reading comprehension skills.

        The point in question is whether flipping burgers can be likened to having sex. PeggyLuWho says that these two things are similar and accuse abolitionist feminists of treating sex as a human activity that is **special**.

        Of course being forced to perform domestic work is terrible, but I bet even PeggyLuWho would admit that experiencing rape is more terrible and the physical and emotional effects of rape vs forced domestic work are more traumatic. Therefore, if she admits this is, then she also has to admit that most people place a higher value on sex than other human experiences.

        1. PeggyLuWho
          PeggyLuWho February 6, 2013 at 12:28 pm |

          Hey jackass, rape isn’t sex. And sex isn’t different from other human experience and activity because rape.

        2. Wendy Lyon
          Wendy Lyon February 6, 2013 at 12:39 pm |

          Forced domestic workers are often raped, and sometimes tortured. In my research I’ve come across a number of examples where women fled domestic servitude for what they considered less exploitative/abusive work in the sex industry. The assumption that sex work is absolutely the worst thing that a woman can do simply isn’t shared by all of those doing it, even the ones who really would rather not be doing it at all.

        3. Elle Fury
          Elle Fury February 6, 2013 at 2:34 pm |

          [TRIGGER WARNING: repeated use of the word rape (TW added by moderator)]

          Hey jackass

          Nice! Clearly someone is running out of arguments…

          Since I am either not explaining myself very well or you are deliberately trying not to understand my point let me explain it one more time via a mathematical equation.

          You said:

          sex= cooking burgers

          Therefore, if you add force to the equation than the results (i.e. the emotional trauma one experiences) should be the same:

          force ( or absence of consent) + cooking burgers = x amount of emotional trauma

          and

          force ( or absence of consent) + sex (a.k.a. rape) = x amount of emotional trauma

          But that isn’t the answer most people would agree with. Rather the answer most people would agree with is:

          force (or absence of consent) + sex (a.k.a. rape)= 10x amount of emotional trauma

          So why is this if all that is different in these situations is the sex factor unless there is a different value placed on sex?

        4. PeggyLuWho
          PeggyLuWho February 6, 2013 at 4:36 pm |

          TW for the repeated use of the word ‘rape’

          Since you seem to like these equations…

          sex = an activity involving erotic stimulation and sometimes resulting in physical pleasure to varying degrees

          rape = an act of violence.

          rape =/= not sex

          rape =/= sex + force

          rape = rape

          the idea that rape is some variant of sex = rape culture

          the idea that sex is a human activity that is sacred and special because sometimes people perpetrate violence against others, which has nothing to do with sex = confounding at best, but really just HELLA DUMB

          the idea that any person who doesn’t hold sex up on a pedestal as some sort of sacred activity, and who has sex just ’cause or to make a few bucks MUST BE broken, damaged, traumatized and NEEDS TO BE SAVED = HELLA PATRIARCHAL BULLSHIT

        5. Elle Fury
          Elle Fury February 6, 2013 at 8:50 pm |

          @PeggyLuWho

          The definition of rape from Dictionary.com:
          “the unlawful compelling of a person through physical force or duress to have sexual intercourse”

          From Oxford:
          ” a crime, typically committed by a man, of forcing another person to have sexual intercourse with the offender against their will”

          From Merriam:
          “unlawful sexual activity and usually sexual intercourse carried out forcibly or under threat of injury against the will usually of a female or with a person who is beneath a certain age or incapable of valid consent”

    3. matlun
      matlun February 6, 2013 at 12:40 pm |

      So if someone locked you in a kitchen and forced you to cook burgers you would feel the same physical and emotional distress as you would if someone locked you in a bedroom and raped you?

      That seems a nonsense argument to me.

      In both cases, the activity is bad with no consent. There is no need to argue that both situations are equivalent to argue that consent is the critical difference. Ie both sides agree that slavery is bad. It seems pointless and fairly irrelevant to debate which type of slavery is worse.

      The issue where there is disagreement is how we should view unforced prostitution, so that seems a more productive front for debate.

      1. Elle Fury
        Elle Fury February 6, 2013 at 2:39 pm |

        What is a nonsense argument is that sex is the same as flipping burgers. But I hear it from the pro sex industry lobby all the time, so unfortunately, it needs to be discussed.

        1. matlun
          matlun February 6, 2013 at 4:02 pm |

          What is a nonsense argument is that sex is the same as flipping burgers.

          That is not a nonsense argument. That argument is one side of the very core difference between the two positions.

          One side consider getting paid for sex as being in the same category as getting paid for any other type of work. Not “the same” in all aspects, but in principle the same type of transaction.

          The other side considers sex to be sacred or in some way categorically different from most other types of activity and something that should never be exchanged for money.

          This is a deep and perhaps irreconcilable difference in a value judgement about how we look at sex.

          Note that this is very different from a discussion about slavery. Everyone already agrees slavery is wrong, which makes your argument above a distraction IMO.

        2. SunlessNick
          SunlessNick February 8, 2013 at 4:02 pm |

          What is a nonsense argument is that sex is the same as flipping burgers.

          I don’t think that sex-fun or sex-work are the same as flipping burgers. However, I do think that flipping burgers deserves a place in the argument for a different reason – that reason being that it’s not the bottom end of menial labour. People trafficked into slavery don’t always end up in the prostitution industry – they’re just as likely to end up in sweatshops – coerced factory labour with no out, and usually no recourse to the authorities.

          Do you believe that working at MacDonalds as the best out of a series of poor economic choices is the same as being forced at the point of violence to work in a sweatshop? Neither may be desirable, but only one is a crime, the other is just crappy. It may be good social justice to work towards crappy jobs not being an economic necessity, but doing so doesn’t require pretending that they’re tantamount to slavery in a sweatshop.

          It’s the same with sex work. Going into it because it’s the least bad of a set of bad economic options is not the same as being raped or enslaved. And again, it’s good social justice – better than in the case of fast food – to make sure no one’s pushed into sex work by bad economics. But doing that doesn’t require pretending that it’s the same as rape-slavery, or that sex workers who say they’re not being raped are too stupid, deluded, or collaborative to understand or admit to their own lives.

  27. Rob in CT
    Rob in CT February 6, 2013 at 9:32 am |

    Interesting that you compare sex to cooking burgers….

    Well… both are jobs. Work for pay. I am paid to sit in this cubicle and do my job. Now, I much prefer this job to the idea of being paid for sex (not that anyone would pay me, but that’s another matter), but that’s me. Perhaps others feel differently. I can’t quite wrap my mind around it, but look: on some level, receiving pay for labor is “whoring” yourself. You sell yourself for money. There’s a reason I loathe job interviews.

    We all know what happened to workers when there were no worker protections, right? Now we have some, and while bad things still happen, your average factory worker in the US is in a much better place now than 100 years ago. With prostitution illegal, you can’t exactly apply OSHA to it, can you? It’s a black market.

  28. rox
    rox February 6, 2013 at 12:57 pm |

    I have many friends and family members in sex work and personally I don’t think sex work is healthy but I also think that sexual abuse in relationships is itself NOT technically illegal. What I call sexual abuse being using advantage to exploit someone who might be harmed by what you’re taking from them due to their desperate circumstance.

    That is what bothers me about sex work and why I absolutely refuse to support sex work as an ethical profession until we have provided supports to people with disabilities and mental illness and childhood abuse issues who could use financial assistance with housing and shelter and living expenses due to difficulties with work.

    Until that is present, sex and relationships based on this kind of survival are harmful and imbalanced and I refuse to pretend men who engage in this kind of power imbalanced sexual activity should be seen as ethical. I do however think that eating and having stable shelter is more important than avoiding unpleasant or abusive sex.

    There are many situations where I understand a persons decision to have sex they don’t want to be having or that is harmful to them for the sake of money.

    All of this say is– the root problem is poverty and difficulty getting education and degrees, usually due to childhood abuse, unstable family life (even if the family has money), mental illness, cognitive impairment or other problems that affect work performance.

    I think personally, if a person is having a hard time holding a job, they need help. I don’t care what the behavioral/emotional problem is- most people need help repairing patterns that make work difficult and for some people it’s just not possible to function in today’s workforce.

    To me, if we care about women, we need to care about that reality. Making things better for sex workers who love sex work for the sake of it can come after we address the needs of women who feel like it is the ONLY sustainable option that matches their work capacity.

    I am a disabled person who is a dependant and I have the option of relying on family/government. If I did not have that option I wouldn’t think twice about having sex for living expenses as a better option than starving and slowly going insane on the streets. That said, you can’t for a minute convince me to respect men (or women) who want sex to help a person in need.

    I believe we should help our fellow humans in need without forcing them to take it up the ass as payment. The barbaric aspect is that we would abandon the needy right in front of us at all. And that is really on the hands of everyone, not just men who use that to their advantage to get sex from disadvantaged women.

    I don’t like prostitution. I also don’t like abusive relationships, or power imbalanced relationships. I also don’t like poverty, starvation, homelessness, joblessness… etc…

    It’s a jungle out there, we all have to survive. The predators will seek prey. But I wish we could work together to make it… not such a cruel and vicious jungle out there for people who are struggling.

  29. rox
    rox February 6, 2013 at 1:06 pm |

    Also I feel like using people for sex with the dangling carrot of money is exactly the kind of protection workers are being protected against.

    People will eat mercury if they are in bad enough circumstances and you offer to pay them enough.

    There are people who can’t meet the average work places work requirements and sex work and often drug dealing are two professions that allow people with disabilities and no hope of stable employment to … exist.

    It makes me seethe with rage when men think that because a woman is willing to take it up the ass for exchange for food that inherently means it’s the same level of degrading as cooking burgers. I’ve worked food service industry most of my jobs and that is just bullshit.

    I get there are women who feel empowered by sex work and feel like it’s the same as making burgers, but I don’t think that’s how all sex workers feel knowing many myself.

    And I know male sex workers who are tormented by submitting to sex for housing/shelter/money etc so it’s not just about women for me, but about the fact that FOR SOME people the TORTURE of livingwith that is worth protecting people from.

  30. rox
    rox February 6, 2013 at 1:08 pm |

    And you know, for survival people will do interesting things to you and in theory it’s better to live than to die, for many of us who look back on what we endured to survive, it’s kind of like… well…. I guess… it’s good I’m alive now. Maybe.

    Cue drug addiction.

    1. Li
      Li February 6, 2013 at 1:46 pm |

      I think what really shits me about the “sex workers don’t have any agency” line is that it kind of just massively misunderstands agency. I’ve made a lot of choices relating to survive some pretty serious mental illness and some of those choices (especially self medicating with various substances, which HI I AM A PROBLEM DRINKER NICE TO MEET YOU) have been really damaging and actually sometimes I think I probably would have been better off just dying a long time ago. But having made damaging choices doesn’t mean I didn’t have some degree of agency in them even though I had to make those choices to survive.

      That’s the context I understand things like survival sex or sex work by poor women in. The choices involved may be between absolutely shitty options but they’re still choices, and acting like choosing sex work means you don’t have agency and drank the koolaid and choosing not-sex-work means you still have agency just acts to foreclose the discussion on what is *limiting* people’s agency in order to make an erroneous point about them *not having agency at all*.

      1. rox
        rox February 6, 2013 at 1:57 pm |

        I hear what you’re saying, but I still think saying poor (whether emotionally/financially/etc) people “have agency” can be leveling a kind of “choseness” of unwanted experiences that is cruel and unwarranted.

        IT just strikes me as an attempt to make poor people accountable for their bad poor people decisions because clearly they “wanted” it if they let it happen.

        1. rox
          rox February 6, 2013 at 1:58 pm |

          For example, people being sexually abused also have agency. So what? That means they want the abuse? That means the abuse is empowering?

        2. Li
          Li February 6, 2013 at 2:02 pm |

          I guess the problem is that otherwise you hit an arbitrary line as to where people suddenly acquire agency, and I’m really suspicious of that being used to frame the choices of poor people or mentally ill people as unacceptable but the choices of middle class and able bodied people as legitimate.

          Like, in the other direction to what you’re saying you do get these messages that poor people’s decisions are axiomatically bad because obviously they don’t have any real choice or whatever. Which I kind of consider also toxic.

        3. Li
          Li February 6, 2013 at 2:05 pm |

          I don’t actually think people being abused have agency over that abuse. Sexual abuse is a decision made by someone else over their bodies.

  31. rox
    rox February 6, 2013 at 1:14 pm |

    I guess to me when this debate is willing to throw people seriously psychologically harmed by sex work under the bus as a necessary casualties of making sex work fun for people who like it, it just makes me enraged.

    The point of this original article though are good ones about the fact that some feminists are doing it wrong and we need to fix that.

    To be, if addressing women’s poverty and disabilities working in most workplaces isn’t part of that, we aren’t really caring about women.

  32. Li
    Li February 6, 2013 at 2:07 pm |

    This is probably way to late in the thread to ask: but how do those people who advocate jailing buyers square that position against the other abolitionist movement? You know, the prison one. Because in addition to thinking that the Swedish model is terrible for sex workers themselves I also think that putting people into the prison system for buying sex is 1. just adding to already obscene prison populations and 2. likely to do exactly what the prison system does to everyone else that goes into it and brutalise them/put them in close proximity to criminal networks and organised crime thus achieving the opposite of rehabilitation.

    1. the_leanover
      the_leanover February 6, 2013 at 2:55 pm |

      I agree. But let’s bear in mind that not everyone is writing from a US perspective, eh? The ‘Nordic model’ originated in the Nordic countries, where the prison system is entire worlds away from the US prison system, and the UK is somewhere between the two. I, too, would be suspicious of anyone advocating prison-based solutions for just about anything in the US.

      1. Li
        Li February 6, 2013 at 2:58 pm |

        Yes, I know, given I’m writing from Australia. We still have prison abolition activism here.

      2. Wendy Lyon
        Wendy Lyon February 6, 2013 at 3:05 pm |

        I’m writing from Ireland, and I would also be extremely reluctant to add to the prison population. Although interestingly the organised anti-sex work campaign here has decided that buying sex should not carry a prison sentence. Reason being that they (incorrectly) believe a fine-only penalty would make the accused ineligible for criminal legal aid.

        Which is fucked up on a number of levels, and very telling, I think.

  33. mistress matisse
    mistress matisse February 6, 2013 at 3:12 pm |

    I see some people say “we don’t want to put sex workers in jail”. But – that’s what decriminalization means. It means you want the removal of laws that control and criminalize what consenting adult women can do with their bodies sexually.
    Once women’s bodies are no longer being controlled by the state, then systems to prevent abuse can easily be constructed because there not a tension between arresting/protecting the woman, as there is now.

  34. Bagelsan
    Bagelsan February 6, 2013 at 3:22 pm |

    Conflating “sex work” and “sex trafficking” is fucking ridiculous, and absolutely cheerfully throws trafficked children and women under the bus in the name of “listening” to sex workers — an entirely different group of people than slaves are. Do we address classism against the cyclically impoverished by listening to that one guy who couldn’t afford the nicest country club? No. Do we address rape by listening to accounts of consensual lovemaking? No. Even if we’re pushing to prioritize the voices of people affected by sex trafficking, listening to sex workers (consent implied) isn’t the same thing at all.

    So sure, I think we absolutely need to ask trafficked people what would help them in order to stop trafficking. Does this mean asking your local happy middle-class sex worker what would help them? No. It’s a totally different question.

    1. afb1221
      afb1221 February 6, 2013 at 4:18 pm |

      agreed.

    2. roro80
      roro80 February 6, 2013 at 5:35 pm |

      Maybe I’m misunderstanding your point, but the point of the article is that the primary effect of the anti-trafficking folks is to harm sex workers, regardless of whether they were trafficked. Whatever the intent of the anit-trafficking group is, arresting more sex workers doesn’t seem to be helping, and in fact it is harmful. So yes, they are two different questions. I don’t see either being asked by the anti-trafficking groups targeted in this article. I find it quite problematic.

      Honest question: in your opinion, should the primary focus of anti-trafficking activism be to arrest and jail sex workers? Should it be to end sex work entirely, as is the stated goal of most of the major voices working in the anti-trafficking groups?

    3. roro80
      roro80 February 6, 2013 at 5:54 pm |

      In case it wasn’t clear, I do think that conflating “sex work” and “sex trafficking” is fucking ridiculous. Conflating “anti-sex-trafficking activists” with “anti-sex-work activists” is not fucking ridiculous if they are the same people. The ones with the biggest voices and most power certainly do seem to be the same people.

    4. mistress matisse
      mistress matisse February 6, 2013 at 6:05 pm |

      That’s exactly my point: help the people that WANT it. Supporting laws that arrest any women who has sex for reasons the state deems unacceptable (ie, money has changed hands) does nothing to help people who are in trouble and are in need of help. We, the happy sex workers you dismiss, are not asking you to help us. The existing laws prevent US from helping YOU help THEM. If sex-workers did not fear arrest, we could do a lot more highly visible and accessible harm-reduction education about how women can work more safely, how they can keep themselves healthy, and yes, about strategies for how to exit sex work. If our behavior was decriminalized, sex-workers-by-choice could potentially be first reporters on anything that seemed wrong, whether it was people being victimized by another person, or people who are in a situation of extreme poverty, drug use, uncontrolled mental illness, or other issues that make sex work a negative choice for them. I have worked at strip clubs, legal brothels, and massage parlors, and I have known women who were in trouble and in need of help. Hell, I get emails from women every day, asking for my advice. I have always talked to women like this, urged them to seek that help, told them about resources and options that existed for their situation, but it’s tough to convince a woman that she can change her situation when she rightfully fears being arrested if she calls attention to herself from the straight culture. And even more so when she thinks anyone she asks for any sort of help will insist she immediately give up her means of income (which she doesn’t always see as her worst problem) as a condition of receiving it.

  35. BobChaos23
    BobChaos23 February 6, 2013 at 4:52 pm |

    “Well, I can’t say I envy Feministe’s moderators. I’m glad you all are enjoying yourselves though! Bob the troll is here and so I’m out. You can waste each other’s time. Which is clearly something you enjoy immensely. This kind of ‘discourse’ is where feminism goes to die.”

    Meghan, you are completely disingenuous. You complain about people “derailing”, but refuse to address the points made. When people call you on the fact that you are avoiding questions, you call them a troll as a bait and switch tactic.

    People like you, Meghan, troll the very concept of feminism, as you bring nothing to the discussion…you are simply here to preach.

  36. jemima101
    jemima101 February 6, 2013 at 5:35 pm |

    A couple of points, someone up thread quotes Melissa fucking Farley ( I am congenitally unable to say her name without swearing) She is the feminist I quoted at lenght who made the hilarious gang rape and incest jokes about sex workers. The age of first entry into sex work being 14 comes from her.

    Her research has been discredited, she has been thrown out of court in Canada and no reputable psychological organisation will use her or her data. The original research, which was not peer reviewed or conducted under any conditions a reputable researcher would tolerate was on people under 18. So amazingly they had a low of entry.

    There is a great stat by stat analysis of the kind of work Farley produces here.

    http://cybersolidaires.typepad.com/files/complaint-to-apa-against-mfarley.pdf

    Another point, people are using in an ideal world, if you can prove you have no mental health issues, if you shit moonbeams faux pro sex work stance.

    To deny abuse victims, rape victims and those with mental health issues the ability to choose for themselves is paternalistic and abusive in and of itself. As my tutor says, everyone is doing the best they can with the resources they have available.

  37. Aphrodite Andrews
    Aphrodite Andrews February 6, 2013 at 6:15 pm |

    No doubt this is going to cause a few ruffled feathers, but I feel I need to speak up anyway.

    I strongly oppose sex trafficking, and find it horrifying that so many women end up engaging in prostitution or other forms of sex work simply because they are forced to, either by coercion or life circumstance. These women need to be protected, supported, educated and given other choices in life and arresting them is the worst way to “rescue” them. There are so many better options if as a society we were willing to throw the same kind of money and effort into it as say…breast cancer.

    I find one subject that I feel is an echoing silence in the halls of feminism lately regarding sex workers rights, and of course it was not addressed here. What about the rights of women who actually WANT to do sex work? I would love to see a world where women were free to choose or not choose sex work simply on the basis of whether or not they enjoy it and find it fulfilling. I feel that sex workers rights, both for those who want to escape, and those who want to enter it is one of the last frontiers of women’s rights and in order to address it realistically we need to take a close look at the stigma associated with not only sex work but with sexually active women in general.

    Part of the article stated “I would never voluntarily have sex for money, therefore any woman who has sex for money must be a victim, a moral failure, or both.” Thus, the women who hold this position get to have their penetration and eat it too: the sex they have is fine, but the sex prostitutes have is disgusting and deserves to be illegal.”

    I feel that categorizing sex into “good” or “bad”, “moral” or “immoral” is really nobody’s business as long as everyone is of legal age, not being coerced and capable of giving informed consent. So many people are incredibly threatened by a happy, sexually open, guilt-free woman and want to label her as a slut, home-wrecker, whore or any number of other derogatory terms. They are even more hostile toward one who also chooses to make a living, either legal or illegal off of her sexuality. If we can choose to risk ourselves on the field of battle and go to war, with it’s attendant risks of grave physical and emotional harm, why can’t we choose how we use our bodies in the marketplace as well? Both have their risks but one is seen as noble while the other is seen as a sell-out. When are we going to have our rights defended? When is anyone even going to talk about it at all?

    1. roro80
      roro80 February 6, 2013 at 6:54 pm |

      I agree with your general point of view, but I’d like to point out that it seems from this comment that you misunderstood the article and didn’t read the comments.

  38. Codi Johnson
    Codi Johnson February 7, 2013 at 11:24 am |

    So, this is what I’ve gathered from reading the blogs, comments, and articles about the sex trade: Anyone who thinks selling sex for money is wrong MUST be transphobic or some dinosaur feminist out to destroy feminism by allying herself with conservatives. Personally, the sex trade fails the ‘icky’ test. That means it doesn’t feel right. However, like many other things in this world, making it illegal, combined with its popularity, would simply open up a vast even uglier black market (compare it with the drug trade). So perhaps the better approach is to legalize and attempt to mitigate the damage.

    But apparently, we can’t have that discussion because anyone who isn’t 100% on board with it being legitimate through and through must be transphobic or whatever. I’m so sick of transphobic being thrown at anyone who thinks people might actually be male or female and that having an operation and wearing a dress isn’t going to make a man into a woman. Yes, I understand sex and gender isn’t so black and white, but that pertains to BOTH sides here. The pro trans side sounds just as black and white, just as convinced they are 100% right. I don’t know who’s right, but I know feminists are getting divided as a result of it, and that can only be good for non feminists.

    1. Sheelzebub
      Sheelzebub February 7, 2013 at 11:30 am |

      I’m so sick of transphobic being thrown at anyone who thinks people might actually be male or female and that having an operation and wearing a dress isn’t going to make a man into a woman.

      You know, I’ve stayed out of both of these discussions because I’ve seen a lot of logic fail and erasure on both sides. Having said that, this is disgusting, bigoted, and shitty of you to say. Yes, when you deny that someone can actually be born into the wrong body WRT gender presentation, when you deny that your body’s sex organs and your gender may not match up, it’s actually transphobic.

      I do not pretend to know much about trans* issues at all, but that’s why I typically keep my fucking mouth shut. I really wish you would follow suit. Because what you’re saying is hurtful and actually, well, divisive.

      Now fuck right off.

    2. Li
      Li February 7, 2013 at 11:30 am |

      But apparently, we can’t have that discussion because anyone who isn’t 100% on board with it being legitimate through and through must be transphobic or whatever. I’m so sick of transphobic being thrown at anyone who thinks people might actually be male or female and that having an operation and wearing a dress isn’t going to make a man into a woman.

      I do not think people are going to stop calling people who think that transphobic since that is pretty much a textbook example of transphobia.

      And personally, I do not actually want feminists to be divided over whether or not a particularly marginalised category of women are fully human either, but I think we radically differ in what we think the solution to that is.

    3. amblingalong
      amblingalong February 7, 2013 at 11:54 am |

      I drafted a couple sarcastic responses but none of them really did your post justice, so I’m just going to go with this: Nobody cares about your contributions. You will find no validation for your fucked-up transphobic gender essentialism here. You are a shitty excuse human being and you should never again write anything here, or for that matter anywhere, ever again. Go away.

    4. OutrageandSprinkles
      OutrageandSprinkles February 7, 2013 at 3:07 pm |

      You’re transphobic. Have a nice day!

    5. Caperton
      Caperton February 7, 2013 at 3:19 pm | *

      Well, you can’t have that discussion here, because you don’t get to comment here anymore.

    6. Donna L
      Donna L February 7, 2013 at 3:36 pm |

      having an operation and wearing a dress isn’t going to make a man into a woman.

      I’ve never claimed that either of those things is what “made” me a woman.

    7. BobChaos23
      BobChaos23 February 7, 2013 at 4:26 pm |

      Only about as transphobic in much the same way that insisting that gay people cannot “really” get married because you need a man and a woman for that, or asking a gay male couple “which one of you is the woman in bed?” will get you defined as “homophobic”. LOL

    8. BobChaos23
      BobChaos23 February 7, 2013 at 4:28 pm |

      Also, no one cares whether YOU personally find something “icky”. See previous comments about homophobia. ^_^

    9. roro80
      roro80 February 8, 2013 at 5:51 pm |

      If it weren’t so dangerous and common and ugly a perspective, this comment would be hilarious. “I’m not transphobic, I just don’t believe trans people exist and that being pro-trans is bad!”

  39. tigtog
    tigtog February 7, 2013 at 6:32 pm | *

    Due to moderator unavailability today, this thread has been placed into full moderation. Comments will be released as time allows, but may be delayed for quite some time.

  40. Cora
    Cora February 8, 2013 at 7:17 am |

    I’m really scared to even post, but here goes.

    I understand the pro-sex work commenters points, but I was wondering about the effects of sex work on a larger scale, outside of the individual sex worker. What percentage of sex workers are women, and what percentage are men? I once heard a statistic that said about 20% of sex workers are men, but who knows where that came from, if it’s accurate, and if it was including transwomen. Anyway, my point is, if women are the vast majority of sex workers, what effect does this have on people’s opinions of all women? When people see that all the criminals on the nightly news are black, they often think that black people are unusually criminalistic. In fact, my university stopped reporting the race of suspects in campus-wide incident reports just to provide less fodder for racism. (Pretty much every report said the suspect was a black guy.) What will the effect of having state sanctioned prostitution in which a huge majority of sex workers are women? Will it make people think of women in general as primarily sexual objects, even more than they already do?

    Please bear in mind that I’m not advocating one side over the other, because I honestly don’t know enough either way. I’m not saying we should sacrifice the rights of sex workers, but I was just wondering about this point.

    Also, I wish we had a more diverse body of sex workers commenting in these threads. So many sex workers are working class or poor women of color, but most people who frequent feminist blogs aren’t. Feminism has always tended to focus on upper-middle class white ladies, and I guess that’s why as a WOC I often take it with a grain of salt.

  41. The Sex Trade Issue | thefeministblogproject

    [...] submitted by two guest bloggers, Debbie and Laurie, entitled “The War on Sex Workers” (http://www.feministe.us/blog/archives/2013/02/05/the-war-on-sex-workers/), argues that “the war on ‘sex trafficking’” is actually a war on sex [...]

Comments are closed.